null

Human TAX1BP1 cDNA Clone BC050358 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL771448HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAX1BP1
Gene ID:
8887
Accession #:
BC050358
Plasmid:
pUC
€716.00
Frequently bought together:

Description

Human TAX1BP1 cDNA Clone BC050358 pUC Plasmid | Cusabio

Gene Name: TAX1BP1

Gene ID: 8887

Accession Number: BC050358

Vector: pUC

Sequence: ATGACATCCTTTCAAGAAGTCCCATTGCAGACTTCCAACTTTGCCCATGTCATCTTTCAAAATGTGGCCAAGAGTTACCTTCCTAATGCACACCTGGAATGTCATTACACCTTAACTCCATATATTCATCCACATCCAAAAGATTGGGTTGGTATATTCAAGGTTGGATGGAGTACTGCTCGTGATTATTACACGTTTTTATGGTCCCCTATGCCTGAACATTATGTGGAAGGATCAACAGTCAATTGTGTACTAGCATTCCAAGGATATTACCTTCCAAATGATGATGGAGAATTTTATCAGTTCTGTTACGTTACCCATAAGGGTGAAATTCGTGGAGCAAGTACACCTTTCCAGTTTCGAGCTTCTTCTCCAGTTGAAGAGCTGCTTACTATGGAAGATGAAGGAAATTCTGACATGTTAGTGGTGACCACAAAAGCAGGCCTTCTTGAGTTGAAAATTGAGAAAACCATGAAAGAAAAAGAAGAACTGTTAAAGTTAATTGCCGTTCTGGAAAAAGAAACAGCACAACTTCGAGAACAAGTTGGGAGAATGGAAAGAGAACTTAACCATGAGAAAGAAAGATGTGACCAACTGCAAGCAGAACAAAAGGGTCTTACTGAAGTAACACAAAGCTTAAAAATGGAAAATGAAGAGTTTAAGAAGAGGTTCAGTGATGCTACATCCAAAGCCCATCAGCTTGAGGAAGATATTGTGTCAGTAACACATAAAGCAATTGAAAAAGAAACCGAATTAGACAGTTTAAAGGACAAACTCAAGAAGGCACAACATGAAAGAGAACAACTTGAATGTCAGTTGAAGACAGAGAAGGATGAAAAGGAACTTTATAAGGTACATTTGAAGAATACAGAAATAGAAAATACCAAGCTTATGTCAGAGGTCCAGACTTTAAAAAATATAGATGGGAACAAAGAAAGCGTGATTACTCATTTCAAAGAAGAGATTGGCAGGCTGCAGTTATGTTTGGCTGAAAAGGAAAATCTGCAAAGAACTTTCCTGCTTACAACCTCAAGTAAAGAAGATACTTGTTTTTTAAAGGAGCAACTTCGTAAAGCAGAGGAACAGGTTCAGGCAACTCGGCAAGAAGTTGTCTTTCTGGCTAAAGAACTCAGTGATGCTGTCAACGTACGAGACAGAACGATGGCAGACCTGCATACTGCACGCTTGGAAAACGAGAAAGTGAAAAAGCAGTTAGCTGATGCAGTGGCAGAACTTAAACTAAATGCTATGAAAAAAGATCAGGACAAGACTGATACACTGGAACACGAACTAAGAAGAGAAGTTGAAGATCTGAAACTCCGTCTTCAGATGGCTGCAGACCATTATAAAGAAAAATTTAAGGAATGCCAAAGGCTCCAAAAACAAATAAACAAACTTTCAGATCAATCAGCTAATAATAATAATGTCTTCACAAAGAAAACGGGGAATCAGCAGAAAGTGAATGATGCTTCAGTAAACACAGACCCAGCCACTTCTGCCTCTACTGTAGATGTAAAGCCATCACCTTCTGCAGCAGAGGCAGATTTTGACATAGTAACAAAGGGGCAAGTCTGTGAAATGACCAAAGAAATTGCTGACAAAACAGAAAAGTATAATAAATGTAAACAACTCTTGCAGGATGAGAAAGCAAAATGCAATAAATATGCTGATGAACTTGCAAAAATGGAGCTGAAATGGAAAGAACAAGTGAAAATTGCTGAAAATGTAAAACTTGAACTAGCTGAAGTACAGGACAATTATAAAGAACTTAAAAGGAGTCTAGAAAATCCAGCAGAAAGGAAAATGGAAGGTCAGAATTCCCAGAGTCCTCAATGTTTCAAAACATGCTCAGAGCAAAATGGTTATGTTCTCACATTGTCAAATGCACAACCAGTTCTGCAATATGGTAATCCTTATGCATCTCAGGAAACAAGAGATGGAGCAGATGGTGCTTTTTACCCAGATGAAATACAAAGGCCACCTGTCAGAGTCCCCTCTTGGGGACTGGAAGACAATGTTGTCTGCAGCCAGCCTGCTCGAAACTTTAGTCGGCCTGATGGCTTAGAGGACTCTGAGGATAGCAAAGAAGATGAGAATGTGCCTACTGCTCCTGATCCTCCAAGTCAACATTTACGTGGGCATGGGACAGGCTTTTGCTTTGATTCCAGCTTTGATGTTCACAAGAAGTGTCCCCTCTGTGAGTTAATGTTTCCTCCTAACTATGATCAGAGCAAATTTGAAGAACATGTTGAAAGTCACTGGAAGGTGTGCCCGATGTGCAGCGAGCAGTTCCCTCCTGACTATGACCAGCAGGTGTTTGAAAGGCATGTGCAGACCCATTTTGATCAGAATGTTCTAAATTTTGACTAG

Length: 2370

View AllClose

0 Reviews

View AllClose