null

Human TARDBP cDNA Clone BC071657 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL621652HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TARDBP
Gene ID:
23435
Accession #:
BC071657
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human TARDBP cDNA Clone BC071657 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: TARDBP

Gene ID: 23435

Accession Number: BC071657

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCTGAATATATTCGGGTAACCGAAGATGAGAACGATGAGCCCATTGAAATACCATCGGAAGACGATGGGACGGTGCTGCTCTCCACGGTTACAGCCCAGTTTCCAGGGGCGTGTGGGCTTCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTAGAAGGAATTCTGCATGCCCCAGATGCTGGCTGGGGAAATCTGGTGTATGTTGTCAACTATCCAAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTCCAGAAAACATCCGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACCGAACAGGACCTGAAAGAGTATTTTAGTACCTTTGGAGAAGTTCTTATGGTGCAGGTCAAGAAAGATCTTAAGACTGGTCATTCAAAGGGGTTTGGCTTTGTTCGTTTTACGGAATATGAAACACAAGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGCAAACTTCCTAATTCTAAGCAAAGCCAAGATGAGCCTTTGAGAAGCAGAAAAGTGTTTGTGGGGCGCTGTACAGAGGACATGACTGAGGATGAGCTGCGGGAGTTCTTCTCTCAGTACGGGGATGTGATGGATGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCCTTTGTTACATTTGCAGATGATCAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTTCATATATCCAATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATGTAG

Length: 1245

View AllClose

0 Reviews

View AllClose