null

Human TAF8 cDNA Clone BC119678 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL773805HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAF8
Gene ID:
129685
Accession #:
BC119678
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human TAF8 cDNA Clone BC119678 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: TAF8

Gene ID: 129685

Accession Number: BC119678

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCCGACGCGGCGGCCACAGCTGGGGCCGGTGGCTCCGGAACGAGATCGGGAAGTAAACAGTCCACTAACCCTGCCGATAACTATCATCTGGCCCGGAGGAGAACCCTGCAGGTGGTTGTGAGCTCCTTGCTGACAGAGGCAGGGTTTGAGAGTGCCGAGAAAGCATCCGTGGAAACGCTGACAGAGATGCTGCAGAGCTACATTTCAGAAATTGGGAGAAGTGCCAAGTCTTACTGTGAGCACACAGCCAGGACCCAGCCCACACTGTCCGATATCGTGGTCACACTTGTTGAGATGGGTTTCAATGTGGACACTCTCCCTGCTTATGCAAAACGGTCTCAGAGGATGGTCATCACTGCTCCTCCGGTGACCAATCAGCCAGTGACCCCCAAGGCCCTCACTGCAGGGCAGAACCGACCCCACCCGCCGCACATCCCCAGCCATTTTCCTGAGTTCCCTGATCCCCACACCTACATCAAAACTCCGACGTACCGTGAGCCCGTGTCAGACTACCAGGTCCTGCGGGAGAAGGCTGCATCCCAGAGGCGCGATGTGGAGCGGGCACTTACCCGTTTCATGGCCAAGACAGGCGAGACTCAGAGTCTTTTCAAAGATGACGTCAGCACATTTCCATTGATTGCTGCCAGACCTTTCACCATCCCCTACCTGACAGCTCTTCTTCCGTCTGAACTGGAGATGCAACAAATGGAAGAGACAGATTCCTCGGAGCAGGATGAACAGACAGACACAGAGAACCTTGCTCTTCATATCAGCATGGAGGATTCTGGAGCCGAGAAGGAGAACACCTCTGTCCTGCAGCAGAACCCCTCCTTGTCGGGTAGCCGGAATGGGGAGGAGAACATCATCGATAACCCTTATCTGCGGCCGGTGAAGAAGCCCAAGATCCGCAGGAAGAAGCCAGATACATTCTAG

Length: 936

View AllClose

0 Reviews

View AllClose