null

Human TAF1A cDNA Clone BC013808 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL614895HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAF1A
Gene ID:
9015
Accession #:
BC013808
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human TAF1A cDNA Clone BC013808 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: TAF1A

Gene ID: 9015

Accession Number: BC013808

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTGATTTCAGTGAAGAATTAAAAGGGCCTGTGACAGATGATGAAGAAGTGGAAACATCTGTGCTCAGTGGTGCAGGAATGCATTTTCCTTGGCTTCAAACATACGTAGAAACTGTGGCCATTGGAGGGAAAAGGAGGAAGGATTTTGCTCAGACAACAAGTGCTTGTTTAAGTTTTATCCAAGAAGCTCTGCTGAAGCACCAATGGCAGCAAGCTGCAGAATACATGTACAGTTATTTTCAGACCTTGGAAGATTCAGATAGCTACAAAAGGCAGGCTGCACCTGAGATTATTTGGAAGCTCGGAAGTGAAATTCTATTTTATCATCCCAAAAGCAACATGGAGAGTTTCAATACTTTTGCTAACCGGATGAAAAATATTGGCGTCATGAATTATTTAAAGATCTCCTTACAACATGCATTATACCTTCTGCATCATGGAATGCTTAAAGATGCTAAGAGAAATCTGAGTGAGGCAGAGACATGGAGACATGGTGAAAATACGTCTTCCCGGGAAATATTAATCAACCTTATTCAGGCCTATAAAGGGCTTTTACAGTATTATACCTGGTCTGAAAAGAAGATGGAATTGTCAAAGCTTGATAAGGATGATTATGCTTACAATGCAGTAGCCCAGGATGTGTTCAACCACAGCTGGAAGACATCTGCAAATATTTCTGCATTGATTAAAATTCCTGGAGTTTGGGACCCTTTTGTGAAGAGTTATGTAGAAATGCTGGAATTCTATGGGGATCGAGATGGAGCCCAAGAGGTACTCACCAATTATGCATATGATGAAAAGTTTCCATCAAATCCAAATGCCCATATCTACTTATACAACTTTCTAAAGAGACAGAAGGCACCAAGATCAAAATTGATAAGTGTGCTTAAGATTTTGTATCAGATTGTACCATCTCATAAATTGATGTTGGAATTCCATACATTACTTAGAAAATCAGAAAAAGAAGAACACCGTAAACTGGGGTTGGAGGTATTATTTGGAGTCTTAGATTTTGCCGGATGCACTAAGAATATAACTGCTTGGAAATACTTGGCAAAATATCTGAAAAATATCTTAATGGGAAACCACCTTGCGTGGGTTCAAGAAGAGTGGAACTCCAGGAAAAACTGGTGGCCAGGGTTTCATTTCAGCTACTTTTGGGCAAAAAGTGATTGGAAGGAAGATACAGCTTTGGCCTGTGAGAAAGCTTTTGTGGCTGGTTTACTGTTAGGAAAAGGTTGTAGATATTTCCGGTATATTTTAAAGCAAGATCACCAAATCTTAGGGAAGAAAATTAAGCGGATGAAGAGATCTGTGAAAAAATACAGTATTGTAAATCCAAGACTCTGA

Length: 1353

View AllClose

0 Reviews

View AllClose