null

Human TAF12 cDNA Clone BC011986 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL624102HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAF12
Gene ID:
6883
Accession #:
BC011986
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human TAF12 cDNA Clone BC011986 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: TAF12

Gene ID: 6883

Accession Number: BC011986

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACCAGTTTGGCCCCTCAGCCCTAATCAACCTCTCCAATTTCTCATCCATAAAACCGGAACCAGCCAGCACCCCTCCACAAGGCTCCATGGCCAATAGTACTGCAGTGGTAAAGATACCAGGCACTCCTGGGGCAGGAGGTCGTCTTAGCCCTGAAAACAATCAGGTATTGACCAAGAAGAAATTACAGGACTTAGTAAGAGAAGTGGATCCTAATGAGCAGTTGGATGAAGATGTGGAGGAGATGCTGCTGCAGATTGCTGATGATTTTATCGAGAGTGTGGTGACAGCAGCCTGTCAGCTTGCGCGGCATCGCAAGTCTAGCACCCTGGAGGTGAAAGATGTCCAGCTGCATTTAGAGCGCCAGTGGAACATGTGGATCCCAGGATTTGGCTCTGAAGAAATCCGACCCTACAAAAAAGCTTGCACCACAGAAGCTCACAAACAGAGAATGGCATTGATCCGGAAAACAACCAAGAAATAA

Length: 486

View AllClose

0 Reviews

View AllClose