null

Human TAF11 cDNA Clone BC021972 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL624027HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAF11
Gene ID:
6882
Accession #:
BC021972
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human TAF11 cDNA Clone BC021972 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: TAF11

Gene ID: 6882

Accession Number: BC021972

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGACGATGCCCACGAGTCGCCCTCCGACAAAGGTGGAGAGACAGGGGAGTCGGATGAGACGGCCGCTGTGCCCGGGGACCCGGGGGCTACCGACACCGATGGAATCCCAGAGGAAACTGACGGAGACGCAGATGTGGACTTGAAAGAAGCTGCAGCGGAGGAAGGCGAGCTCGAGAGTCAGGATGTCTCAGATTTAACAACAGTTGAAAGGGAAGACTCATCATTACTTAATCCTGCAGCCAAAAAACTGAAAATAGATACCAAAGAAAAGAAAGAGAAAAAGCAGAAAGTAGATGAAGATGAGATTCAGAAGATGCAAATCCTGGTTTCTTCTTTTTCTGAGGAGCAGCTGAACCGTTATGAAATGTATCGCCGCTCAGCTTTCCCTAAGGCAGCCATCAAAAGGCTGATCCAGTCCATCACTGGCACCTCTGTGTCTCAGAATGTTGTTATTGCTATGTCTGGTATTTCCAAGGTTTTCGTCGGGGAGGTGGTAGAAGAAGCACTGGATGTGTGTGAGAAGTGGGGAGAAATGCCACCACTACAACCCAAACATATGAGGGAAGCCGTTAGAAGGTTAAAGTCAAAAGGACAGATCCCTAACTCGAAGCACAAAAAAATCATCTTCTTCTAG

Length: 636

View AllClose

0 Reviews

View AllClose