null

Human TAC1 cDNA Clone BC018047 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL023062HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
TAC1
Gene ID:
6863
Accession #:
BC018047
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human TAC1 cDNA Clone BC018047 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: TAC1

Gene ID: 6863

Accession Number: BC018047

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAAATCCTCGTGGCCTTGGCAGTCTTTTTTCTTGTCTCCACTCAGCTGTTTGCAGAAGAAATAGGAGCCAATGATGATCTGAATTACTGGTCCGACTGGTACGACAGCGACCAGATCAAGGAGGAACTGCCGGAGCCCTTTGAGCATCTTCTGCAGAGAATCGCCCGGAGACCCAAGCCTCAGCAGTTCTTTGGATTAATGGGCAAACGGGATGCTGATTCCTCAATTGAAAAACAAGTGGCCCTGTTAAAGGCTCTTTATGGACATGGCCAGATCTCTCACAAAAGACATAAAACAGATTCCTTTGTTGGACTAATGGGCAAAAGAGCTTTAAATTCTGTGGCTTATGAAAGGAGTGCAATGCAGAATTATGAAAGAAGACGTTAA

Length: 390

View AllClose

0 Reviews

View AllClose