Cusabio Customized Plasmid
Human SUMF2 cDNA Clone BC065222 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL839844HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SUMF2
- Gene ID:
- 25870
- Accession #:
- BC065222
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human SUMF2 cDNA Clone BC065222 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: SUMF2
Gene ID: 25870
Accession Number: BC065222
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCGCGTCCTCCGGGGGGCATCCTGGATCGACACAGCTGATGGCTCTGCCAATCACCGGGCCCGGGTCACCACCAGGATGGGCAACACTCCAGATTCAGCCTCAGACAACCTCGGTTTCCGCTGTGCTGCAGACGCAGGCCGGCCGCCAGGGGAGCTGTAA
Length: 162
Related Products
Human SUMF2 cDNA Clone BC111092 pUC Plasmid
Cusabio pUC Plasmid
$402.00
Human SUMF2 cDNA Clone BC111092 pUC Plasmid | CusabioGene Name: SUMF2Gene ID: 25870Accession Number: BC111092Vector: pUCSequence:...
- SKU:
- CSB-CL839844HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SUMF2
- Gene ID:
- 25870
- Accession #:
- BC111092
- Plasmid:
- pUC
Human SUMF2 cDNA Clone BC015600 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human SUMF2 cDNA Clone BC015600 pENTR223.1 or pUC Plasmid | CusabioGene Name: SUMF2Gene ID: 25870Accession Number: BC015600Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL839844HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SUMF2
- Gene ID:
- 25870
- Accession #:
- BC015600
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid | CusabioGene Name: DNAL1Gene ID: 83544Accession Number: BC005343Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL683815HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- DNAL1
- Gene ID:
- 83544
- Accession #:
- BC005343
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM133AGene ID: 286499Accession Number: BC113385Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL822736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM133A
- Gene ID:
- 286499
- Accession #:
- BC113385
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM46CGene ID: 54855Accession Number: BC131726Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL736203HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM46C
- Gene ID:
- 54855
- Accession #:
- BC131726
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC