Cusabio Customized Plasmid
Human SUMF2 cDNA Clone BC065222 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL839844HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SUMF2
- Gene ID:
- 25870
- Accession #:
- BC065222
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human SUMF2 cDNA Clone BC065222 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: SUMF2
Gene ID: 25870
Accession Number: BC065222
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCGCGTCCTCCGGGGGGCATCCTGGATCGACACAGCTGATGGCTCTGCCAATCACCGGGCCCGGGTCACCACCAGGATGGGCAACACTCCAGATTCAGCCTCAGACAACCTCGGTTTCCGCTGTGCTGCAGACGCAGGCCGGCCGCCAGGGGAGCTGTAA
Length: 162
Related Products
Human SUMF2 cDNA Clone BC015600 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human SUMF2 cDNA Clone BC015600 pENTR223.1 or pUC Plasmid | CusabioGene Name: SUMF2Gene ID: 25870Accession Number: BC015600Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL839844HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SUMF2
- Gene ID:
- 25870
- Accession #:
- BC015600
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human SUMF2 cDNA Clone BC111092 pUC Plasmid
Cusabio pUC Plasmid
€335.00
Human SUMF2 cDNA Clone BC111092 pUC Plasmid | CusabioGene Name: SUMF2Gene ID: 25870Accession Number: BC111092Vector: pUCSequence:...
- SKU:
- CSB-CL839844HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SUMF2
- Gene ID:
- 25870
- Accession #:
- BC111092
- Plasmid:
- pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€438.00
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC