Cusabio Customized Plasmid
Human SULT1C4 cDNA Clone BC058861 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL022940HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SULT1C4
- Gene ID:
- 27233
- Accession #:
- BC058861
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human SULT1C4 cDNA Clone BC058861 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: SULT1C4
Gene ID: 27233
Accession Number: BC058861
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGCCTTACACGACATGGAGGATTTTACATTTGATGGAACAAAGCGCTTAAGTGTCAACTACGTGAAGGGAATTCTTCAACCGACAGACACCTGTGACATCTGGGATAAGATCTGGAACTTCCAAGCCAAGCCTGATGACCTGCTTATTTCTACCTATCCTAAAGCAGGAACAACATGGACTCAGGAGATAGTGGAATTAATACAAAATGAAGGTGATGTGGAGAAAAGTAAACGGGCACCGACTCATCAACGATTTCCTTTCCTCGAAATGAAAATCCCATCCTTAGGATCTGGTGAGTATAAATAG
Length: 309
Related Products
Human SULT1C4 cDNA Clone BC125043 pUC Plasmid
Cusabio pUC Plasmid
£222.40
Human SULT1C4 cDNA Clone BC125043 pUC Plasmid | CusabioGene Name: SULT1C4Gene ID: 27233Accession Number: BC125043Vector: pUCSequence:...
- SKU:
- CSB-CL022940HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SULT1C4
- Gene ID:
- 27233
- Accession #:
- BC125043
- Plasmid:
- pUC
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid | CusabioGene Name: DNAL1Gene ID: 83544Accession Number: BC005343Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL683815HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- DNAL1
- Gene ID:
- 83544
- Accession #:
- BC005343
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM133AGene ID: 286499Accession Number: BC113385Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL822736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM133A
- Gene ID:
- 286499
- Accession #:
- BC113385
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM46CGene ID: 54855Accession Number: BC131726Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL736203HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM46C
- Gene ID:
- 54855
- Accession #:
- BC131726
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FASLG cDNA Clone BC017502 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human FASLG cDNA Clone BC017502 pENTR223.1 or pUC Plasmid | CusabioGene Name: FASLGGene ID: 356Accession Number: BC017502Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL008434HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FASLG
- Gene ID:
- 356
- Accession #:
- BC017502
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC