Cusabio Customized Plasmid
Human STAU2 cDNA Clone BC008370 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL885729HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- STAU2
- Gene ID:
- 27067
- Accession #:
- BC008370
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human STAU2 cDNA Clone BC008370 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: STAU2
Gene ID: 27067
Accession Number: BC008370
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCTTCAAATAAATCAGATGTTCTCAGTGCAGCTGAGTCTTGGTGAGCAGACATGGGAATCCGAAGGCAGCAGTATAAAGAAGGCTCAGCAGGCTGTTGCCAATAAAGCTTTGACTGAATCTACGCTTCCCAAACCAGTTCAGAAGCCACCCAAAAGTAATGTTAACAATAACCCAGGCAGTATAACTCCAACTGTGGAACTGAATGGGCTTGCTATGAAAAGGGGAGAGCCTGCCATCTACAGGCCATTAGATCCAAAGCCATTCCCAAATTATAGAGCTAATTACAACTTTCGGGGCATGTACAATCAGAGATGA
Length: 318
Related Products
Human STAU2 cDNA Clone BC110447 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human STAU2 cDNA Clone BC110447 pENTR223.1 or pUC Plasmid | CusabioGene Name: STAU2Gene ID: 27067Accession Number: BC110447Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL885729HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- STAU2
- Gene ID:
- 27067
- Accession #:
- BC110447
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human STAU2 cDNA Clone BC008369 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£277.60
Human STAU2 cDNA Clone BC008369 pENTR223.1 or pUC Plasmid | CusabioGene Name: STAU2Gene ID: 27067Accession Number: BC008369Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL885729HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- STAU2
- Gene ID:
- 27067
- Accession #:
- BC008369
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£277.60
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC41Gene ID: 10489Accession Number: BC004953Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL614889HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC41
- Gene ID:
- 10489
- Accession #:
- BC004953
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid | CusabioGene Name: LMO3Gene ID: 55885Accession Number: BC026311Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL844705HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LMO3
- Gene ID:
- 55885
- Accession #:
- BC026311
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRIQ1Gene ID: 84125Accession Number: BC005399Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL842693HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRIQ1
- Gene ID:
- 84125
- Accession #:
- BC005399
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC