Cusabio Customized Plasmid
Human STAU2 cDNA Clone BC008370 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL885729HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- STAU2
- Gene ID:
- 27067
- Accession #:
- BC008370
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human STAU2 cDNA Clone BC008370 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: STAU2
Gene ID: 27067
Accession Number: BC008370
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCTTCAAATAAATCAGATGTTCTCAGTGCAGCTGAGTCTTGGTGAGCAGACATGGGAATCCGAAGGCAGCAGTATAAAGAAGGCTCAGCAGGCTGTTGCCAATAAAGCTTTGACTGAATCTACGCTTCCCAAACCAGTTCAGAAGCCACCCAAAAGTAATGTTAACAATAACCCAGGCAGTATAACTCCAACTGTGGAACTGAATGGGCTTGCTATGAAAAGGGGAGAGCCTGCCATCTACAGGCCATTAGATCCAAAGCCATTCCCAAATTATAGAGCTAATTACAACTTTCGGGGCATGTACAATCAGAGATGA
Length: 318
Related Products
Human STAU2 cDNA Clone BC110447 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human STAU2 cDNA Clone BC110447 pENTR223.1 or pUC Plasmid | CusabioGene Name: STAU2Gene ID: 27067Accession Number: BC110447Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL885729HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- STAU2
- Gene ID:
- 27067
- Accession #:
- BC110447
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human STAU2 cDNA Clone BC008369 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£277.60
Human STAU2 cDNA Clone BC008369 pENTR223.1 or pUC Plasmid | CusabioGene Name: STAU2Gene ID: 27067Accession Number: BC008369Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL885729HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- STAU2
- Gene ID:
- 27067
- Accession #:
- BC008369
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid | CusabioGene Name: DNAL1Gene ID: 83544Accession Number: BC005343Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL683815HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- DNAL1
- Gene ID:
- 83544
- Accession #:
- BC005343
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM133AGene ID: 286499Accession Number: BC113385Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL822736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM133A
- Gene ID:
- 286499
- Accession #:
- BC113385
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM46CGene ID: 54855Accession Number: BC131726Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL736203HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM46C
- Gene ID:
- 54855
- Accession #:
- BC131726
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC