Cusabio Customized Plasmid
Human SRP9 cDNA Clone BC067845 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL022680HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SRP9
- Gene ID:
- 6726
- Accession #:
- BC067845
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human SRP9 cDNA Clone BC067845 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: SRP9
Gene ID: 6726
Accession Number: BC067845
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCCGCAGTACCAGACCTGGGAGGAGTTCAGCCGCGCTGCCGAGAAGCTTTACCTCGCTGACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAACTTGTGTGTTAAAGTAACAGATGATTTAGTTAGACAGTGTCTTGCTCTGTTGCTCAGGCTGCAGTGCAGTGGCATGATCATAGCTCACTGCATCCTCGACCTCCTGGGCTCAAGCGGTCCTCTTGCTTCAGCCTCCTGA
Length: 249
Related Products
Human SRP9 cDNA Clone BC008443 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human SRP9 cDNA Clone BC008443 pENTR223.1 or pUC Plasmid | CusabioGene Name: SRP9Gene ID: 6726Accession Number: BC008443Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL022680HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SRP9
- Gene ID:
- 6726
- Accession #:
- BC008443
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human SRP9 cDNA Clone BC021995 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human SRP9 cDNA Clone BC021995 pENTR223.1 or pUC Plasmid | CusabioGene Name: SRP9Gene ID: 6726Accession Number: BC021995Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL022680HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SRP9
- Gene ID:
- 6726
- Accession #:
- BC021995
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human TMEM206 cDNA Clone BC006320 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMEM206Gene ID: 55248Accession Number: BC006320Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL023800HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMEM206
- Gene ID:
- 55248
- Accession #:
- BC006320
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$525.60
Human TLR10 cDNA Clone BC109112 pENTR223.1 or pUC Plasmid | CusabioGene Name: TLR10Gene ID: 81793Accession Number: BC109112Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL023600HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TLR10
- Gene ID:
- 81793
- Accession #:
- BC109112
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human TMCO3 cDNA Clone BC012564 pENTR223.1 or pUC Plasmid | CusabioGene Name: TMCO3Gene ID: 55002Accession Number: BC012564Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL754406HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- TMCO3
- Gene ID:
- 55002
- Accession #:
- BC012564
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC