Cusabio Customized Plasmid
Human SRP9 cDNA Clone BC008443 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL022680HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SRP9
- Gene ID:
- 6726
- Accession #:
- BC008443
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human SRP9 cDNA Clone BC008443 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: SRP9
Gene ID: 6726
Accession Number: BC008443
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGCCGCAGTACCAGACCTGGGAGGAGTTCAGCCGCGCTGCCGAGAAGCTTTACCTCGCTGACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAACTTGTGTGTTAAAGTAACAGATGATTTAGTTTGTTTGGTGTATAAAACAGACCAAGCTCAAGATGTAAAGAAGATTGAGAAATTCCACAGTCAACTAATGCGACTTATGGTAGCCAAGGAAGCCCGCAATGTTACCATGGAAACTGAGTGA
Length: 261
Related Products
Human SRP9 cDNA Clone BC021995 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human SRP9 cDNA Clone BC021995 pENTR223.1 or pUC Plasmid | CusabioGene Name: SRP9Gene ID: 6726Accession Number: BC021995Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL022680HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SRP9
- Gene ID:
- 6726
- Accession #:
- BC021995
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human SRP9 cDNA Clone BC067845 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human SRP9 cDNA Clone BC067845 pENTR223.1 or pUC Plasmid | CusabioGene Name: SRP9Gene ID: 6726Accession Number: BC067845Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL022680HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SRP9
- Gene ID:
- 6726
- Accession #:
- BC067845
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid | CusabioGene Name: DNAL1Gene ID: 83544Accession Number: BC005343Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL683815HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- DNAL1
- Gene ID:
- 83544
- Accession #:
- BC005343
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM133AGene ID: 286499Accession Number: BC113385Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL822736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM133A
- Gene ID:
- 286499
- Accession #:
- BC113385
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM46CGene ID: 54855Accession Number: BC131726Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL736203HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM46C
- Gene ID:
- 54855
- Accession #:
- BC131726
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC