Cusabio Customized Plasmid
Human SRGN cDNA Clone BC022313 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL022664HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SRGN
- Gene ID:
- 5552
- Accession #:
- BC022313
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human SRGN cDNA Clone BC022313 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: SRGN
Gene ID: 5552
Accession Number: BC022313
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGATGCAGAAGCTACTCAAATGCAGTCGGCTTGTCCTGGCTCTTGCCCTCATCCTGGTTCTGGAATCCTCAGTTCAAGGTAAGACTCAGGAGTCTTGTTCCCCAGCCATCTTCTCTGTAAGCCCTGTGGTCCATGCAAGTCATTATATTCATTTTAAGGCATAG
Length: 165
Related Products
Human SRGN cDNA Clone BC015516 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human SRGN cDNA Clone BC015516 pENTR223.1 or pUC Plasmid | CusabioGene Name: SRGNGene ID: 5552Accession Number: BC015516Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL022664HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SRGN
- Gene ID:
- 5552
- Accession #:
- BC015516
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MAP2K3 cDNA Clone BC032478 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human MAP2K3 cDNA Clone BC032478 pENTR223.1 or pUC Plasmid | CusabioGene Name: MAP2K3Gene ID: 5606Accession Number: BC032478Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL013412HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MAP2K3
- Gene ID:
- 5606
- Accession #:
- BC032478
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MAPK1IP1L cDNA Clone BC015621 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human MAPK1IP1L cDNA Clone BC015621 pENTR223.1 or pUC Plasmid | CusabioGene Name: MAPK1IP1LGene ID: 93487Accession Number: BC015621Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL850865HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MAPK1IP1L
- Gene ID:
- 93487
- Accession #:
- BC015621
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MFSD11 cDNA Clone BC002753 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human MFSD11 cDNA Clone BC002753 pENTR223.1 or pUC Plasmid | CusabioGene Name: MFSD11Gene ID: 79157Accession Number: BC002753Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL013761HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MFSD11
- Gene ID:
- 79157
- Accession #:
- BC002753
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human MED30 cDNA Clone BC008226 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human MED30 cDNA Clone BC008226 pENTR223.1 or pUC Plasmid | CusabioGene Name: MED30Gene ID: 90390Accession Number: BC008226Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL822225HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- MED30
- Gene ID:
- 90390
- Accession #:
- BC008226
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC