Cusabio Customized Plasmid
Human SPRR2A cDNA Clone BC096108 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL022612HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SPRR2A
- Gene ID:
- 6700
- Accession #:
- BC096108
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human SPRR2A cDNA Clone BC096108 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: SPRR2A
Gene ID: 6700
Accession Number: BC096108
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTCTTATCAACAGCAGCAGTGCAAGCAGCCCTGCCAGCCACCTCCTGTGTGCCCCACGCCAAAGTGCCCAGAACCATGTCCACCCCCGAAGTGCCCTGAGCCCTGCCCACCACCAAAGTGTCCACAGCCCTGCCCACCTCAGCAGTGCCAGCAGAAATATCCTCCTGTGACACCTTCCCCACCCTGCCAGTCAAAGTATCCACCGAAGAGCAAGTAA
Length: 219
Related Products
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human DNAL1 cDNA Clone BC005343 pENTR223.1 or pUC Plasmid | CusabioGene Name: DNAL1Gene ID: 83544Accession Number: BC005343Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL683815HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- DNAL1
- Gene ID:
- 83544
- Accession #:
- BC005343
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FAM133A cDNA Clone BC113385 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM133AGene ID: 286499Accession Number: BC113385Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL822736HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM133A
- Gene ID:
- 286499
- Accession #:
- BC113385
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FAM46C cDNA Clone BC131726 pENTR223.1 or pUC Plasmid | CusabioGene Name: FAM46CGene ID: 54855Accession Number: BC131726Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL736203HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FAM46C
- Gene ID:
- 54855
- Accession #:
- BC131726
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FASLG cDNA Clone BC017502 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FASLG cDNA Clone BC017502 pENTR223.1 or pUC Plasmid | CusabioGene Name: FASLGGene ID: 356Accession Number: BC017502Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL008434HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FASLG
- Gene ID:
- 356
- Accession #:
- BC017502
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FDFT1 cDNA Clone BC003573 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
€214.00
Human FDFT1 cDNA Clone BC003573 pENTR223.1 or pUC Plasmid | CusabioGene Name: FDFT1Gene ID: 2222Accession Number: BC003573Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL008562HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FDFT1
- Gene ID:
- 2222
- Accession #:
- BC003573
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC