Cusabio Customized Plasmid
Human SLC48A1 cDNA Clone BC002759 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL740701HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SLC48A1
- Gene ID:
- 55652
- Accession #:
- BC002759
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human SLC48A1 cDNA Clone BC002759 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: SLC48A1
Gene ID: 55652
Accession Number: BC002759
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGTACATGCAAGATTATTGGAGGACCTGGCTCAAGGGGCTGCGCGGCTTCTTCTTCGTGGGCGTCCTCTTCTCGGCCGTCTCCATCGCTGCCTTCTGCACCTTCCTCGTGCTGGCCATCACCCGGCATCAGAGCCTCACAGACCCCACCAGCTACTACCTCTCCAGCGTCTGGAGCTTCATTTCCTTCAAGTGGGCCTTCCTGCTCAGCCTCTATGCCCACCGCTACCGGGCTGACTTTGCTGACATCAGCATCCTCAGCGATTTCTGA
Length: 270
Related Products
Human SLC48A1 cDNA Clone BC026344 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human SLC48A1 cDNA Clone BC026344 pENTR223.1 or pUC Plasmid | CusabioGene Name: SLC48A1Gene ID: 55652Accession Number: BC026344Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL740701HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SLC48A1
- Gene ID:
- 55652
- Accession #:
- BC026344
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human SLC48A1 cDNA Clone BC011823 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human SLC48A1 cDNA Clone BC011823 pENTR223.1 or pUC Plasmid | CusabioGene Name: SLC48A1Gene ID: 55652Accession Number: BC011823Vector: Vector will be determined during the manufacturing process,...
- SKU:
- CSB-CL740701HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- SLC48A1
- Gene ID:
- 55652
- Accession #:
- BC011823
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$416.40
Human LRRC41 cDNA Clone BC004953 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRC41Gene ID: 10489Accession Number: BC004953Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL614889HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRC41
- Gene ID:
- 10489
- Accession #:
- BC004953
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human LMO3 cDNA Clone BC026311 pENTR223.1 or pUC Plasmid | CusabioGene Name: LMO3Gene ID: 55885Accession Number: BC026311Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL844705HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LMO3
- Gene ID:
- 55885
- Accession #:
- BC026311
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
$256.80
Human LRRIQ1 cDNA Clone BC005399 pENTR223.1 or pUC Plasmid | CusabioGene Name: LRRIQ1Gene ID: 84125Accession Number: BC005399Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL842693HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- LRRIQ1
- Gene ID:
- 84125
- Accession #:
- BC005399
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC