Cusabio Customized Plasmid
Human REG4 cDNA Clone BC017089 pENTR223.1 or pUC Plasmid
- SKU:
- CSB-CL887169HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- REG4
- Gene ID:
- 83998
- Accession #:
- BC017089
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human REG4 cDNA Clone BC017089 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: REG4
Gene ID: 83998
Accession Number: BC017089
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGCTTCCAGAAGCATGCGGCTGCTCCTATTGCTGAGCTGCCTGGCCAAAACAGGAGTCCTGGGTGATATCATCATGAGACCCAGCTGTGCTCCTGGATGGTTTTACCACAAGTCCAATTGCTATGGTTACTTCAGGAAGCTGAGGAACTGGTCTGATGCCGAGCTCGAGTGTCAGTCTTACGGAAACGGAGCCCACCTGGCATCTATCCTGAGTTTAAAGGAAGCCAGCACCATAGCAGAGTACATAAGTGGCTATCAGAGAAGCCAGCCGATATGGATTGGCCTGCACGACCCACAGAAGAGGCAGCAGTGGCAGTGGATTGATGGGGCCATGTATCTGTACAGATCCTGGTCTGGCAAGTCCATGGGTGGGAACAAGCACTGTGCTGAGATGAGCTCCAATAACAACTTTTTAACTTGGAGCAGCAACGAATGCAACAAGCGCCAACACTTCCTGTGCAAGTACCGACCATAG
Length: 477
Related Products
Human ZNF177 cDNA Clone BC012012 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL026558HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF177
- Gene ID:
- 7730
- Accession #:
- BC012012
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF22 cDNA Clone BC010642 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL026588HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF22
- Gene ID:
- 7570
- Accession #:
- BC010642
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF281 cDNA Clone BC060820 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL026637HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF281
- Gene ID:
- 23528
- Accession #:
- BC060820
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF323 cDNA Clone BC065241 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL026672HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF323
- Gene ID:
- 64288
- Accession #:
- BC065241
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF334 cDNA Clone BC024177 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL026682HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF334
- Gene ID:
- 55713
- Accession #:
- BC024177
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human ZNF343 cDNA Clone BC011862 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
- SKU:
- CSB-CL026689HU1
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- ZNF343
- Gene ID:
- 79175
- Accession #:
- BC011862
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC