null

Human RAB5A cDNA Clone BC001267 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL019213HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RAB5A
Gene ID:
5868
Accession #:
BC001267
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human RAB5A cDNA Clone BC001267 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: RAB5A

Gene ID: 5868

Accession Number: BC001267

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTAGTCGAGGCGCAACAAGACCCAACGGGCCAAATACTGGAAATAAAATATGCCAGTTCAAACTAGTACTTCTGGGAGAGTCCGCTGTTGGCAAATCAAGCCTAGTGCTTCGTTTTGTGAAAGGCCAATTTCATGAATTTCAAGAGAGTACCATTGGGGCTGCTTTTCTAACCCAAACTGTATGTCTTGATGACACTACAGTAAAGTTTGAAATATGGGATACAGCTGGTCAAGAACGATACCATAGCCTAGCACCAATGTACTACAGAGGAGCACAAGCAGCCATAGTTGTATATGATATCACAAATGAGGAGTCCTTTGCAAGAGCAAAAAATTGGGTTAAAGAACTTCAGAGGCAAGCAAGTCCTAACATTGTAATAGCTTTATCGGGAAACAAGGCCGACCTAGCAAATAAAAGAGCAGTAGATTTCCAGGAAGCACAGTCCTATGCAGATGACAATAGTTTATTATTCATGGAGACATCCGCTAAAACATCAATGAATGTAAATGAAATATTCATGGCAATAGCTAAAAAATTGCCAAAGAATGAACCACAAAATCCAGGAGCAAATTCTGCCAGAGGAAGAGGAGTAGACCTTACCGAACCCACACAACCAACCAGGAATCAGTGTTGTAGTAACTAA

Length: 648

View AllClose

0 Reviews

View AllClose