null

Human RAB35 cDNA Clone BC015931 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL614887HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RAB35
Gene ID:
11021
Accession #:
BC015931
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human RAB35 cDNA Clone BC015931 pENTR223.1 Plasmid | Cusabio

Gene Name: RAB35

Gene ID: 11021

Accession Number: BC015931

Vector: pENTR223.1

Sequence: ATGGCCCGGGACTACGACCACCTCTTCAAGCTGCTCATCATCGGCGACAGCGGTGTGGGCAAGAGCAGTTTACTGTTGCGTTTTGCAGACAACACTTTCTCAGGCAGCTACATCACCACGATCGGAGTGGATTTCAAGATCCGGACCGTGGAGATCAACGGGGAGAAGGTGAAGCTGCAGATCTGGGACACAGCGGGGCAGGAGCGCTTCCGCACCATCACCTCCACGTATTATCGGGGGACCCACGGGGTCATTGTGGTTTACGACGTCACCAGTGCCGAGTCCTTTGTCAACGTCAAGCGGTGGCTTCACGAAATCAACCAGAACTGTGATGATGTGTGCCGAATATTAGTGGGTAATAAGAATGACGACCCTGAGCGGAAGGTGGTGGAGACGGAAGATGCCTACAAATTCGCCGGGCAGATGGGCATCCAGTTGTTCGAGACCAGCGCCAAGGAGAATGTCAACGTGGAAGAGATGTTCAACTGCATCACGGAGCTGGTCCTCCGAGCAAAGAAAGACAACCTGGCAAAACAGCAGCAGCAACAACAGAACGATGTGGTGAAGCTCACGAAGAACAGTAAACGAAAGAAACGCTGCTGCTAA

Length: 606

View AllClose

0 Reviews

View AllClose