null

Human RAB2B cDNA Clone BC066366 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL823880HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RAB2B
Gene ID:
84932
Accession #:
BC066366
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human RAB2B cDNA Clone BC066366 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: RAB2B

Gene ID: 84932

Accession Number: BC066366

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAAAACAAATCAAACTGCAAATCTGGGATACGGGGAGCAGCTGGAGCACTGCTGGTGTACGACATTACAAGGCGTGAAACCTTCAACCACCTGACCTCATGGTTAGAGGATGCCCGGCAGCACTCTAGTTCCAACATGGTTATCATGCTCATTGGGAATAAGAGTGACCTAGAGTCCCGCAGGGATGTGAAGAGAGAAGAAGGAGAGGCCTTTGCTAGGGAGCATGGACTTATATTCATGGAAACTTCAGCCAAAACAGCCTGCAATGTTGAAGAGGCCTTCATTAACACAGCCAAAGAAATATATAGGAAGATCCAGCAGGGTTTATTTGATGTCCACAATGAGGCAAATGGCATCAAGATTGGGCCCCAACAGTCAATTTCAACATCAGTGGGACCCAGTGCCTCCCAGCGGAACTCTCGTGACATAGGGTCCAACTCTGGCTGCTGCTGA

Length: 456

View AllClose

0 Reviews

View AllClose