null

Human RAB2A cDNA Clone BC008929 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL019180HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RAB2A
Gene ID:
5862
Accession #:
BC008929
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human RAB2A cDNA Clone BC008929 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: RAB2A

Gene ID: 5862

Accession Number: BC008929

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGTACGCCTATCTCTTCAAGTACATCATAATCGGCGACACAGGTGTTGGTAAATCATGCTTATTGCTACAGTTTACAGACAAGAGGTTTCAGCCAGTGCATGACCTTACTATTGGTGTAGAGTTCGGTGCTCGAATGATAACTATTGATGGGAAACAGATAAAACTTCAGATATGGGATACGGCAGGGCAAGAATCCTTTCGTTCCATCACAAGGTCGTATTACAGAGGTGCAGCAGGAGCTTTACTAGTTTACGATATTACACGGAGAGATACATTCAACCACTTGACAACCTGGTTAGAAGATGCCCGCCAGCATTCCAATTCCAACATGGTCATTATGCTTATTGGAAATAAAAGTGATTTAGAATCTAGAAGAGAAGTAAAAAAAGAAGAAGGTGAAGCTTTTGCACGAGAACATGGACTCATCTTCATGGAAACGTCTGCTAAGACTGCTTCCAATGTAGAAGAGGCATTTATTAATACAGCAAAAGAAATTTATGAAAAAATTCAAGAAGGAGTCTTTGACATTAATAATGAGGCAAATGGCATTAAAATTGGCCCTCAGCATGCTGCTACCAATGCAACACATGCAGGCAATCAGGGAGGACAGCAGGCTGGGGGCGGCTGCTGTTGA

Length: 639

View AllClose

0 Reviews

View AllClose