null

Human RAB28 cDNA Clone BC035054 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL019179HU1
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RAB28
Gene ID:
9364
Accession #:
BC035054
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human RAB28 cDNA Clone BC035054 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: RAB28

Gene ID: 9364

Accession Number: BC035054

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGTCGGACTCTGAGGAGGAGAGTCAGGACCGGCAACTGAAAATCGTCGTGCTGGGGGACGGCGCCTCCGGGAAGACCTCCTTAACTACGTGTTTTGCTCAAGAAACTTTTGGGAAACAGTACAAACAAACTATAGGACTGGATTTCTTTTTGAGAAGGATAACATTGCCAGGAAACTTGAATGTTACCCTTCAAATTTGGGATATAGGAGGGCAGACAATAGGAGGCAAAATGTTGGATAAATATATCTATGGAGCACAGGGAGTCCTCTTGGTATATGATATTACAAATTATCAAAGCTTTGAGAATTTAGAAGATTGGTATACTGTGGTGAAGAAAGTGAGCGAGGAGTCAGAAACTCAGCCACTGGTTGCCTTGGTAGGCAATAAAATTGATTTGGAGCATATGCGAACAATAAAACCTGAAAAACACTTACGGTTTTGCCAGGAAAATGGTTTTAGTAGCCACTTTGTCTCAGCCAAGACAGGAGACTCTGTCTTCCTGTGCTTTCAGAAAGTTGCTGCTGAAATCCTTGGGATCAAATTAAACAAAGCAGAAATAGAACAGTCACAGAGGGTGGTGAAGGCAGATATTGTAAACTACAACCAGGAACCTATGTCAAGGACTGTTAACCCTCCTAGAAGCTCTATGTGTGCAGTTCAGTGA

Length: 666

View AllClose

0 Reviews

View AllClose