null

Human RAB1B cDNA Clone BC071169 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL872427HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RAB1B
Gene ID:
81876
Accession #:
BC071169
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human RAB1B cDNA Clone BC071169 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: RAB1B

Gene ID: 81876

Accession Number: BC071169

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACCCCGAATATGACTACCTGTTTAAGCTGCTTTTGATTGGCGACTCAGGCGTGGGCAAGTCATGCCTGCTCCTGCGGTTTGCTGATGACACGTACACAGAGAGCTACATCAGCACCATCGGGGTGGACTTCAAGATCCGAACCATCGAGCTGGATGGCAAAACTATCAAACTTCAGATCTGGGACACAGCGGGCCAGGAACGGTTCCGGACCATCACTTCCAGCTACTACCGGGGGGCTCATGGCATCATCGTGGTGTATGACGTCACTGACCAGGAATCCTACGCCAACGTGAAGCAGTGGCTGCAGGAGATTGACCGCTATGCCAGCGAGAACGTCAATAAGCTCCTGGTGGGCAACAAGAGCGACCTCACCACCAAGAAGGTGGTGGACAACACCACAGCCAAGGAGTTTGCAGACTCTCTGGGCATCCCCTTCTTGGAGACGAGCGCCAAGAATGCCACCAATGTCGAGCAGGCGTTCATGACCATGGCTGCTGAAATCAAAAAGCGGATGGGGCCTGGAGCAGCCTCTGGGGGCGAGCGGCCCAATCTCAAGATCGACAGCACCCCTGTAAAGCCGGCTGGCGGTGGCTGTTGCTAG

Length: 606

View AllClose

0 Reviews

View AllClose