null

Human RAB15 cDNA Clone BC040679 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL019163HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
RAB15
Gene ID:
376267
Accession #:
BC040679
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human RAB15 cDNA Clone BC040679 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: RAB15

Gene ID: 376267

Accession Number: BC040679

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGAAGCAGTACGATGTGCTGTTCCGGCTGCTGCTGATCGGGGACTCCGGGGTGGGCAAGACCTGCCTGCTGTGCCGCTTCACCGACAACGAGTTCCACTCCTCGCACATCTCCACCATCGGTGTTGACTTTAAGATGAAGACCATAGAGGTAGACGGCATCAAAGTGCGGATACAGATCTGGGACACTGCAGGGCAGGAGAGATACCAGACCATCACAAAGCAGTACTATCGGCGGGCCCAGGGGATATTTTTGGTCTATGACATTAGCAGCGAGCGCTCTTACCAGCACATCATGAAGTGGGTCAGTGACGTGGATGAGGTAGGAGATGCCACCTCACTGCCGGGGTGTGGAGAGGGTGCCTCACCGGGGAAGGCAAGGCGAGGGCCAGATGGGAAGGCAAATGCTTCCAGGAAGCTTTGCCTTCCACAGCCCTGGATGAAGACCTCTGGTACGCACCAGAAGGCGTCCAGAAGATCCTTATTGGGAATAAGGCTGATGAGGAGCAGAAACGGCAGGTGGGAAGAGAGCAAGGGCAGCAGCTGGCGAAGGAGTATGGCATGGACTTCTATGAAACAAGTGCCTGCACCAACCTCAACATTAAAGAGTCATTCACGCGTCTGA

Length: 627

View AllClose

0 Reviews

View AllClose