null

Human QPCTL cDNA Clone BC011553 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL868351HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
QPCTL
Gene ID:
54814
Accession #:
BC011553
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human QPCTL cDNA Clone BC011553 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: QPCTL

Gene ID: 54814

Accession Number: BC011553

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCGTTCCGGGGGCCGCGGGCGACCCCGCCTGCGGCTGGGGGAACGTGGCCTCATGGAGCCACTCTTGCCGCCGAAGCGCCGCCTGCTACCGCGGGTTCGGCTCTTGCCTCTGTTGCTGGCGCTGGCCGTGGGCTCGGCGTTCTACACCATTTGGAGCGGCTGGCACCGCAGGACTGAGGAGCTGCCGCTGGGCCGGGAGCTGCGGGTCCCATTGATCGGAAGCCTCCCCGAAGCCCGGCTGCGGAGGGTGGTGGGACAACTGGATCCACAGCGTCTCTGGAGCACTTATCTGCGCCCCCTGCTGGTTGTGCGAACCCCGGGCAGCCCGGGAAATCTCCAAGTCAGAAAGGCAGCCCCGGTGACCCTGCAACTGCTCTTCTTGGATGGTGAAGAGGCGCTGAAGGAGTGGGGACCCAAGGACTCCCTTTACGGTTCCCGGCACCTGGCCCAGCTCATGGAGTCTATACCTCACAGCCCCGGCCCCACCAGGATCCAGGCTATTGAGCTCTTTATGCTTCTTGATCTCCTGGGAGCCCCCAATCCCACCTTCTACAGCCACTTCCCTCGCACGGTCCGCTGGTTCCATCGGCTGAGGAGCATTGAGAAGCGTCTGCACCGTTTGAACCTGCTGCAGTCTCATCCCCAGGAAGTGATGTACTTCCAACCCGGGGAGCCCTTTGGCTCTGTGGAAGACGACCACATCCCCTTCCTCCGCAGAGGGGTACCCGTGCTCCATCTCATCTCCACGCCCTTCCCTGCTGTCTGGCACACCCCTGCGGACACCGAGGTCAATCTCCACCCACCCACGGTACACAACTTATGCCGCATTCTCGCTGTGTTCCTGGCTGAATACCTGGGGCTCTAG

Length: 867

View AllClose

0 Reviews

View AllClose