null

Human PALM cDNA Clone BC019596 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL017413HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
PALM
Gene ID:
5064
Accession #:
BC019596
Plasmid:
pUC
€262.00
Frequently bought together:

Description

Human PALM cDNA Clone BC019596 pUC Plasmid | Cusabio

Gene Name: PALM

Gene ID: 5064

Accession Number: BC019596

Vector: pUC

Sequence: ATGAATTCACAGCAGACGCCGGTGGGCACGCCCAAAGACAAGCGAGTCTCCAACACGCCCCTGAGGACGGTTGACGGCTCCCCCATGATGAAGGCAGTGGTCCATGCTGTGGACGGCACCGCCGAGAACGGGATCCACCCCCTGAGCTCCTCCGAGGTGGACGAACTCATCCACAAAGCGGACGAGGTCACGCTGAGCGAGGCAGGGTCCACGGCCGGGGCAGCAGAGACCCGGGGGGCTGTGGAGGGGGCAGCCCGGACCACGCCCTCCCGGCGGGAGATCACCGGTGTGCAGGCACAGCCAGGCGAGGCCACGTCCGGCCCGCCGGGGATCCAGCCCGGCCAGGAGCCCCCGGTCACAATGATCTTCATGGGTTACCAGAACGTGGAGGATGAGGCCGAGACCAAGAAGGTGCTGGGCCTTCAAGATACCATCACGGCGGAGCTGGTGGTCATCGAAGACGCGGCTGAGCCCAAGGAGCCTGCACCACCCAACGGCAGTGCTGCCGAGCCTCCCACGGAGGCCGCCTCCAGGGAAGAGAATCAGGCGGGGCCCGAGGCCACCACCAGCGACCCCCAGGACCTCGACATGAAGAAGCACCGTTGTAAATGCTGCTCCATCATGTGA

Length: 627

View AllClose

0 Reviews

View AllClose