null

Human PAK7 cDNA Clone BC024179 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL885798HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
PAK7
Gene ID:
57144
Accession #:
BC024179
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human PAK7 cDNA Clone BC024179 pENTR223.1 Plasmid | Cusabio

Gene Name: PAK7

Gene ID: 57144

Accession Number: BC024179

Vector: pENTR223.1

Sequence: ATGTTTGGGAAGAAAAAGAAAAAGATTGAAATATCTGGCCCGTCCAACTTTGAACACAGGGTTCATACTGGGTTTGATGCACAAGAGCAGAAGTTTACCGGCCTTCCCCAGCAGTGGCACAGCCTGTTAGCAGATACGGCCAACAGGCCAAAGCCTATGGTGGACCCTTCATGCATCACACCCATCCAGCTGGCTCCTATGAAGACAATCGTTAGAGGAAACAAACCCTGCAAGGAAACCTCCATCAACGGCCTGCTAGAGGATTTTGACAACATCTCGGTGACTCGCTCCAACTCCCTAAGGAAAGAAAGCCCACCCACCCCAGATCAGGGAGCCTCCAGCCACGGTCCAGGCCACGCGGAAGAAAATGGCTTCATCACCTTCTCCCAGTATTCCAGCGAATCCGATACTACTGCTGACTACACGACCGAAAAGTACAGGGAGAAGAGTCTCTATGGAGATGATCTGGATCCGTATTATAGAGGCAGCCACGCAGCCAAGCAAAATGGGCACGTAATGAAAATGAAGCACGGGGAGGCCTACTATTCTGAGGTGAAGCCTTTGAAATCCGATTTTGCCAGATTTTCTGCCGATTATCACTCACATTTGGACTCACTGAGCAAACCAAGTGAATACAGTGACCTCAAGTGGGAGTATCAGAGAGCCTCGAGTAGCTCCCCTCTGGATTATTCATTCCAATTCACACCTTCTAGAACTGCAGGGACCAGCGGGTGCTCCAAGGAGAGCCTGGCGTACAGTGAAAGTGAATGGGGACCCAGCCTGGATGACTATGACAGGAGGCCAAAGTCTTCGTACCTGAATCAGACAAGCCCTCAGCCCACCATGCGGCAGAGGTCCAGGTCAGGCTCGGGACTCCAGGAACCGATGATGCCATTTGGAGCAAGTGCATTTAAAACCCATCCCCAAGGACACTCCTACAACTCCTACACCTACCCTCGCTTGTCCGAGCCCACAATGTGCATTCCAAAGGTGGATTACGATCGAGCACAGATGGTCCTCAGCCCTCCACTGTCAGGGTCTGACACCTACCCCAGGGGCCCTGCCAAACTACCTCAAAGTCAAAGCAAATCGGGCTATTCCTCAAGCAGTCACCAGTACCCGTCTGGGTACCACAAAGCCACCTTGTACCATCACCCCTCCCTGCAGAGCAGTTCGCAGTACATCTCCACGGCTTCCTACCTGAGCTACCTCAGCCTCTCATCCAGCACCTACCCGCCGCCCAGCTGGGGCTCCTCCTCCGACCAGCAGCCCTCCAGGGTGTCCCATGAACAGTTTCGGGCGGCCCTGCAGCTGGTGGTCAGCCCAGGAGACCCCAGGGAATACTTGGCCAACTTTATCAAAATCGGGGAAGGCTCAACCGGCATCGTATGCATCGCCACCGAGAAACACACAGGGAAACAAGTTGCAGTGAAGAAAATGGACCTCCGGAAGCAACAGAGACGAGAACTGCTTTTCAATGAGGTCGTGATCATGCGGGATTACCACCATGACAATGTGGTTGACATGTACAGCAGCTACCTTGTCGGCGATGAGCTCTGGGTGGTCATGGAGTTTCTAGAAGGTGGTGCCTTGACAGACATTGTGACTCACACCAGAATGAATGAAGAACAGATAGCTACTGTCTGCCTGTCAGTTCTGAGAGCTCTCTCCTACCTTCATAACCAAGGAGTGATTCACAGGGACATAAAAAGTGACTCCATCCTCCTGACAAGCGATGGCCGGATAAAGTTGTCTGATTTTGGTTTCTGTGCTCAAGTTTCCAAAGAGGTGCCGAAGAGGAAATCATTGGTTGGCACTCCCTACTGGATGGCCCCTGAGGTGATTTCTAGGCTACCTTATGGGACAGAGGTGGACATCTGGTCCCTCGGGATCATGGTGATAGAAATGATTGATGGCGAGCCCCCCTACTTCAATGAGCCTCCCCTCCAGGCGATGCGGAGGATCCGGGACAGTTTACCTCCAAGAGTGAAGGACCTACACAAGGTTTCTTCAGTGCTCCGGGGATTCCTAGACTTGATGTTGGTGAGGGAGCCCTCTCAGAGAGCAACAGCCCAGGAACTCCTCGGACATCCATTCTTAAAACTAGCAGGTCCACCGTCTTGCATTGTCCCCCTCATGAGACAATACAGGCATCACTGA

Length: 2160

View AllClose

0 Reviews

View AllClose