null

Human PAIP2 cDNA Clone BC001716 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL859027HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
PAIP2
Gene ID:
51247
Accession #:
BC001716
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human PAIP2 cDNA Clone BC001716 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: PAIP2

Gene ID: 51247

Accession Number: BC001716

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAAAGATCCAAGTCGCAGCAGTACTAGCCCAAGCATCATCAATGAAGATGTGATTATTAACGGTCATTCTCATGAAGATGACAATCCATTTGCAGAGTACATGTGGATGGAAAATGAAGAAGAATTCAACAGACAAATAGAAGAGGAGTTATGGGAAGAAGAATTTATTGAACGCTGTTTCCAAGAAATGCTGGAAGAGGAAGAAGAGCATGAATGGTTTATTCCAGCTCGAGATCTCCCACAAACTATGGACCAAATCCAAGACCAGTTTAATGACCTTGTTATCAGTGATGGCTCTTCTCTGGAAGATCTTGTGGTCAAGAGCAATCTGAATCCAAATGCAAAGGAGTTTGTTCCTGGGGTGAAGTACGGAAATATTTGA

Length: 384

View AllClose

0 Reviews

View AllClose