null

Human PAGE5 cDNA Clone BC110803 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL856943HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
PAGE5
Gene ID:
90737
Accession #:
BC110803
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human PAGE5 cDNA Clone BC110803 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: PAGE5

Gene ID: 90737

Accession Number: BC110803

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGTGAGCATGTAACAAGATCCCAATCCTCAGAAAGAGGAAATGACCAAGAGTCTTCCCAGCCAGTTGGACCTGTGATTGTCCAGCAGCCCACTGAGGAAAAACGTCAAGAAGAGGAACCACCAACTGATAATCAGGGTATTGCACCTAGTGGGGAGATCAAAAATGAAGGAGCACCTGCTGTTCAAGGGACTGATGTGGAAGCTTTTCAACAGGAACTGGCTCTGCTTAAGATAGAGGATGCACCTGGAGATGGTCCTGATGTCAGGGAGGGGACTCTGCCCACTTTTGATCCCACTAAAGTGCTGGAAGCAGGTGAAGGGCAACTATAG

Length: 333

View AllClose

0 Reviews

View AllClose