null

Human P2RY13 cDNA Clone BC041116 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL860651HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
P2RY13
Gene ID:
53829
Accession #:
BC041116
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human P2RY13 cDNA Clone BC041116 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: P2RY13

Gene ID: 53829

Accession Number: BC041116

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACACCACAGTGATGCAAGGCTTCAACAGATCTGAGCGGTGCCCCAGAGACACTCGGATAGTACAGCTGGTATTCCCAGCCCTCTACACAGTGGTTTTCTTGACCGGCATCCTGCTGAATACTTTGGCTCTGTGGGTGTTTGTTCACATCCCCAGCTCCTCCACCTTCATCATCTACCTCAAAAACACTTTGGTGGCCGACTTGATAATGACACTCATGCTTCCTTTCAAAATCCTCTCTGACTCACACCTGGCACCCTGGCAGCTCAGAGCTTTTGTGTGTCGTTTTTCTTCGGTGATATTTTATGAGACCATGTATGTGGGCATCGTGCTGTTAGGGCTCATAGCCTTTGACAGATTCCTCAAGATCATCAGACCTTTGAGAAATATTTTTCTAAAAAAACCTGTTTTTGCAAAAACGGTCTCAATCTTCATCTGGTTCTTTTTGTTCTTCATCTCCCTGCCAAATATGATCTTGAGCAACAAGGAAGCAACACCATCGTCTGTGAAAAAGTGTGCTTCCTTAAAGGGGCCTCTGGGGCTGAAATGGCATCAAATGGTAAATAACATATGCCAGTTTATTTTCTGGACTGTTTTTATCCTAATGCTTGTGTTTTATGTGGTTATTGCAAAAAAAGTATATGATTCTTATAGAAAGTCCAAAAGTAAGGACAGAAAAAACAACAAAAAGCTGGAAGGCAAAGTATTTGTTGTCGTGGCTGTCTTCTTTGTGTGTTTTGCTCCATTTCATTTTGCCAGAGTTCCATATACTCACAGTCAAACCAACAATAAGACTGACTGTAGACTGCAAAATCAACTGTTTATTGCTAAAGAAACAACTCTCTTTTTGGCAGCAACTAACATTTGTATGGATCCCTTAATATACATATTCTTATGTAAAAAATTCACAGAAAAGCTACCATGTATGCAAGGGAGAAAGACCACAGCATCAAGCCAAGAAAATCATAGCAGTCAGACAGACAACATAACCTTAGGCTGA

Length: 1002

View AllClose

0 Reviews

View AllClose