null

Human P2RX5 cDNA Clone BC039015 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL842353HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
P2RX5
Gene ID:
5026
Accession #:
BC039015
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human P2RX5 cDNA Clone BC039015 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: P2RX5

Gene ID: 5026

Accession Number: BC039015

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGGGCAGGCGGGCTGCAAGGGGCTCTGCCTGTCGCTGTTCGACTACAAGACCGAGAAGTATGTCATCGCCAAGAACAAGAAGGTGGGCCTGCTGTACCGGCTGCTGCAGGCCTCCATCCTGGCGTACCTGGTCGTATGGGTGTTCCTGATAAAGAAGGGTTACCAAGACGTCGACACCTCCCTGCAGAGTGCTGTCATCACCAAAGTCAAGGGCGTGGCCTTCACCAACACCTCGGATCTTGGGCAGCGGATCTGGGATGTCGCCGACTACGTCATTCCAGCCCAGGGAGAGAACGTCTTTTTTGTGGTCACCAACCTGATTGTGACCCCCAACCAGCGGCAGAACGTCTGTGCTGAGAATGAAGGCATTCCTGATGGCGCGTGCTCCAAGGACAGCGACTGCCACGCTGGGGAAGCGGTTACAGCTGGAAACGGAGTGAAGACCGGCCGCTGCCTGCGGAGAGAGAACTTGGCCAGGGGCACCTGTGAGATCTTTGCCTGGTGCCCGTTGGAGACAAGCTCCAGGCCGGAGGAGCCATTCCTGAAGGAGGCCGAAGACTTCACCATTTTCATAAAGAACCACATCCGTTTCCCCAAATTCAACTTCTCCAAAAGCAATGTGATGGACGTCAAGGACAGATCTTTCCTGAAATCATGCCACTTTGGCCCCAAGAACCACTACTGCCCCATCTTCCGACTGGGCTCCGTGATCCGCTGGGCCGGGAGCGACTTCCAGGATATAGCCCTGGAGGGTGGCGTGATAGGAATTAATATTGAATGGAACTGTGATCTTGATAAAGCTGCCTCTGAGTGCCACCCTCACTATTCTTTTAGCCGTCTGGACAATAAACTTTCAAAGTCTGTCTCCTCCGGGTACAACTTCAGATTTGCCAGATATTACCGAGACGCAGCCGGGGTGGAGTTCCGCACCCTGATGAAAGCCTACGGGATCCGCTTTGACGTGATGGTGAACGGCAAGGGTGCTTTCTTCTGCGACCTGGTACTCATCTACCTCATCAAAAAGAGAGAGTTTTACCGTGACAAGAAGTACGAGGAAGTGAGGGGCCTAGAAGACAGTTCCCAGGAGGCCGAGGACGAGGCATCGGGGCTGGGGCTATCTGAGCAGCTCACATCTGGGCCAGGGCTGCTGGGGATGCCGGAGCAGCAGGAGCTGCAGGAGCCACCCGAGGCGAAGCGTGGAAGCAGCAGTCAGAAGGGGAACGGATCTGTGTGCCCACAGCTCCTGGAGCCCCACAGGAGCACGTGA

Length: 1269

View AllClose

0 Reviews

View AllClose