null

Human P2RX1 cDNA Clone BC027949 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL017319HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
P2RX1
Gene ID:
5023
Accession #:
BC027949
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human P2RX1 cDNA Clone BC027949 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: P2RX1

Gene ID: 5023

Accession Number: BC027949

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCACGGCGGTTCCAGGAGGAGCTGGCCGCCTTCCTCTTCGAGTATGACACCCCCCGCATGGTGCTGGTGCGTAATAAGAAGGTGGGCGTTATCTTCCGACTGATCCAGCTGGTGGTCCTGGTCTACGTCATCGGGTGGGTGTTTCTCTATGAGAAGGGCTACCAGACCTCGAGCGGCCTCATCAGCAGTGTCTCTGTGAAACTCAAGGGCCTGGCCGTGACCCAGCTCCCTGGCCTCGGCCCCCAGGTCTGGGATGTGGCTGACTACGTCTTCCCAGCCCAGGGGGACAACTCCTTCGTGGTCATGACCAATTTCATCGTGACCCCGAAGCAGACTCAAGGCTACTGCGCAGAGCACCCAGAAGGGGGCATATGCAAGGAAGACAGTGGCTGTACCCCTGGGAAGGCCAAGAGGAAGGCCCAAGGCATCCGCACGGGCAAGTGTGTGGCCTTCAACGACACTGTGAAGACGTGTGAGATCTTTGGCTGGTGCCCCGTGGAGGTGGATGACGACATCCCGCGGTAA

Length: 528

View AllClose

0 Reviews

View AllClose