Cusabio Customized Plasmid
Human OTUB2 cDNA Clone BC000208 pENTR223.1 or pUC Plasmid
(No reviews yet)
Write a Review
- SKU:
- CSB-CL836196HU2
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- OTUB2
- Gene ID:
- 78990
- Accession #:
- BC000208
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Description
Human OTUB2 cDNA Clone BC000208 pENTR223.1 or pUC Plasmid | Cusabio
Gene Name: OTUB2
Gene ID: 78990
Accession Number: BC000208
Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Sequence: ATGGTCTATGAGAAGTACACTGGAAGCGTGGGGGGAACACATGACATGATTTGTGAATATCATCATCTTTGCCAGACAAGTCTCCAGGGGATCCCTGTTTCCCAACTGAAAGGTGTGAACGGACACACACACAGCCTGGATGACGCCTTGGCTGTTCTAAGGGGCTGTAAGGTGGGCTCTGGGCCTTCCAGCTAG
Length: 195
Related Products
Human OTUB2 cDNA Clone BC068058 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human OTUB2 cDNA Clone BC068058 pENTR223.1 or pUC Plasmid | CusabioGene Name: OTUB2Gene ID: 78990Accession Number: BC068058Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL836196HU3
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- OTUB2
- Gene ID:
- 78990
- Accession #:
- BC068058
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human OTUB2 cDNA Clone BC009615 pENTR223.1 Plasmid
Cusabio pENTR223.1 Plasmid
£171.20
Human OTUB2 cDNA Clone BC009615 pENTR223.1 Plasmid | CusabioGene Name: OTUB2Gene ID: 78990Accession Number: BC009615Vector: pENTR223.1Sequence:...
- SKU:
- CSB-CL836196HU1
- Availability:
- 3 to 5 Working Days
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- OTUB2
- Gene ID:
- 78990
- Accession #:
- BC009615
- Plasmid:
- pENTR223.1
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£277.60
Human FZD2 cDNA Clone BC113402 pENTR223.1 or pUC Plasmid | CusabioGene Name: FZD2Gene ID: 2535Accession Number: BC113402Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL622766HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FZD2
- Gene ID:
- 2535
- Accession #:
- BC113402
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human G6PC cDNA Clone BC130478 pENTR223.1 or pUC Plasmid | CusabioGene Name: G6PCGene ID: 2538Accession Number: BC130478Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL009118HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- G6PC
- Gene ID:
- 2538
- Accession #:
- BC130478
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid
Cusabio Customized Plasmid
£171.20
Human FUNDC2 cDNA Clone BC000255 pENTR223.1 or pUC Plasmid | CusabioGene Name: FUNDC2Gene ID: 65991Accession Number: BC000255Vector: Vector will be determined during the manufacturing process, either...
- SKU:
- CSB-CL861153HU
- Availability:
- Inquiry
- Size:
- 10 μg plasmid + 200μl Glycerol
- Gene:
- FUNDC2
- Gene ID:
- 65991
- Accession #:
- BC000255
- Plasmid:
- Vector will be determined during the manufacturing process, either pENTR223.1 or pUC