Human OSMR cDNA Clone BC125209 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL857869HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OSMR
Gene ID:
9180
Accession #:
BC125209
Plasmid:
pUC
€864.00
Frequently bought together:

Description

Human OSMR cDNA Clone BC125209 pUC Plasmid | Cusabio

Gene Name: OSMR

Gene ID: 9180

Accession Number: BC125209

Vector: pUC

Sequence: ATGGCTCTATTTGCAGTCTTTCAGACAACATTCTTCTTAACATTGCTGTCCTTGAGGACTTACCAGAGTGAAGTCTTGGCTGAACGTTTACCATTGACTCCTGTATCACTTAAAGTTTCCACCAATTCTACGCGTCAGAGTTTGCACTTACAATGGACTGTCCACAACCTTCCTTATCATCAGGAATTGAAAATGGTATTTCAGATCCAGATCAGTAGGATTGAAACATCCAATGTCATCTGGGTGGGGAATTACAGCACCACTGTGAAGTGGAACCAGGTTCTGCATTGGAGCTGGGAATCTGAGCTCCCTTTGGAATGTGCCACACACTTTGTAAGAATAAAGAGTTTGGTGGACGATGCCAAGTTCCCTGAGCCAAATTTCTGGAGCAACTGGAGTTCCTGGGAGGAAGTCAGTGTACAAGATTCTACTGGACAGGATATATTGTTCGTTTTCCCTAAAGATAAGCTGGTGGAAGAAGGCACCAATGTTACCATTTGTTACGTTTCTAGGAACATTCAAAATAATGTATCCTGTTATTTGGAAGGGAAACAGATTCATGGAGAACAACTTGATCCACATGTAACTGCATTCAACTTGAATAGTGTGCCTTTCATTAGGAATAAAGGGACAAATATCTATTGTGAGGCAAGTCAAGGAAATGTCAGTGAAGGCATGAAAGGCATCGTTCTTTTTGTCTCAAAAGTACTTGAGGAGCCCAAGGACTTTTCTTGTGAAACCGAGGACTTCAAGACTTTGCACTGTACTTGGGATCCTGGGACGGACACTGCCTTGGGGTGGTCTAAACAACCTTCCCAAAGCTACACTTTATTTGAATCATTTTCTGGGGAAAAGAAACTTTGTACACACAAAAACTGGTGTAATTGGCAAATAACTCAAGACTCACAAGAAACCTATAACTTCACACTCATAGCTGAAAATTACTTAAGGAAGAGAAGTGTCAATATCCTTTTTAACCTGACTCATCGAGTTTATTTAATGAATCCTTTTAGTGTCAACTTTGAAAATGTAAATGCCACAAATGCCATCATGACCTGGAAGGTGCACTCCATAAGGAATAATTTCACATATTTGTGTCAGATTGAACTCCATGGTGAAGGAAAAATGATGCAATACAATGTTTCCATCAAGGTGAACGGTGAGTACTTCTTAAGTGAACTGGAACCTGCCACAGAGTACATGGCGCGAGTACGGTGTGCTGATGCCAGCCACTTCTGGAAATGGAGTGAATGGAGTGGTCAGAACTTCACCACACTTGAAGCTGCTCCCTCAGAGGCCCCTGATGTCTGGAGAATTGTGAGCTTGGAGCCAGGAAATCATACTGTGACCTTATTCTGGAAGCCATTATCAAAACTGCATGCCAATGGAAAGATCCTGTTCTATAATGTAGTTGTAGAAAACCTAGACAAACCATCCAGTTCAGAGCTCCATTCCATTCCAGCACCAGCCAACAGCACAAAACTAATCCTTGACAGGTGTTCCTACCAAATCTGCGTCATAGCCAACAACAGTGTGGGTGCTTCTCCTGCTTCTGTAATAGTCATCTCTGCAGACCCCGAAAACAAAGAGGTTGAGGAAGAAAGAATTGCAGGCACAGAGGGTGGATTCTCTCTGTCTTGGAAACCCCAACCTGGAGATGTTATAGGCTATGTTGTGGACTGGTGTGACCATACCCAGGATGTGCTCGGTGATTTCCAGTGGAAGAATGTAGGTCCCAATACCACAAGCACAGTCATTAGCACAGATGCTTTTAGGCCAGGAGTTCGATATGACTTCAGAATTTATGGGTTATCTACAAAAAGGATTGCTTGTTTATTAGAGAAAAAAACAGGATACTCTCAGGAACTTGCTCCTTCAGACAACCCTCACGTGCTGGTGGATACATTGACATCCCACTCCTTCACTCTGAGTTGGAAAGATTACTCTACTGAATCTCAACCTGGTTTTATACAAGGGTACCATGTCTATCTGAAATCCAAGGCGAGGCAGTGCCACCCACGATTTGAAAAGGCAGTTCTTTCAGATGGTTCAGAATGTTGCAAATACAAAATTGACAACCCGGAAGAAAAGGCATTGATTGTGGACAACCTAAAGCCAGAATCCTTCTATGAGTTTTTCATCACTCCATTCACTAGTGCTGGTGAAGGCCCCAGTGCTACGTTCACGAAGGTCACGACTCCGGATGAACACTCCTCGATGCTGATTCATATCCTACTGCCCATGGTTTTCTGCGTCTTGCTCATCATGGTCATGTGCTACTTGAAAAGTCAGTGGATCAAGGAGACCTGTTATCCTGACATCCCTGACCCTTACAAGAGCAGCATCCTGTCATTAATAAAATTCAAGGAGAACCCTCACCTAATAATAATGAATGTCAGTGACTGTATCCCAGATGCTATTGAAGTTGTAAGCAAGCCAGAAGGGACAAAGATACAGTTCCTAGGCACTAGGAAGTCACTCACAGAAACCGAGTTGACTAAGCCTAACTACCTTTATCTCCTTCCAACAGAAAAGAATCACTCTGGCCCTGGCCCCTGCATCTGTTTTGAGAACTTGACCTATAACCAGGCAGCTTCTGACTCTGGCTCTTGTGGCCATGTTCCAGTATCCCCAAAAGCCCCAAGTATGCTGGGACTAATGACCTCACCTGAAAATGTACTAAAGGCACTAGAAAAAAACTACATGAACTCCCTGGGAGAAATCCCAGCTGGAGAAACAAGTTTGAATTATGTGTCCCAGTTGGCTTCACCCATGTTTGGAGACAAGGACAGTCTCCCAACAAACCCAGTAGAGGCACCACACTGTTCAGAGTATAAAATGCAAATGGCAGTCTCCCTGCGTCTTGCCTTGCCTCCCCCGACCGAGAATAGCAGCCTCTCCTCAATTACCCTTTTAGATCCAGGTGAACACTACTGCTAA

Length: 2940

View AllClose

0 Reviews

View AllClose