Human OSBPL5 cDNA Clone BC039579 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL863946HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OSBPL5
Gene ID:
114879
Accession #:
BC039579
Plasmid:
pUC
€786.00
Frequently bought together:

Description

Human OSBPL5 cDNA Clone BC039579 pUC Plasmid | Cusabio

Gene Name: OSBPL5

Gene ID: 114879

Accession Number: BC039579

Vector: pUC

Sequence: ATGAAGGAGGAGGCCTTCCTCCGGCGCCGCTTCTCCCTGTGTCCACCTTCCTCCACCCCTCAGAAAGTCGACCCCCGGAAGCTCACCCGGAACTTGCTCCTCAGCGGAGACAATGAGCTCTACCCACTCAGCCCAGGGAAGGACATGGAGCCCAACGGCCCGTCGCTGCCCAGGGATGAAGGGCCCCCGACCCCAAGCTCTGCCACGAAGGTGCCACCGGCAGAGTACAGGCTGTGCAACGGGTCAGACAAGGAATGTGTGTCCCCCACCGCCAGGGTCACCAAGAAGGAGACTCTCAAGGCGCAGAAGGAGAACTACCGGCAGGAGAAGAAGCGCGCCACACGGCAGCTGCTCAGCGCTCTGACAGACCCCAGCGTGGTCATCATGGCTGACAGCCTGAAGATCCGCGGCACCCTGAAGAGCTGGACCAAGCTGTGGTGCGTGCTGAAGCCGGGGGTGCTGCTCATCTACAAGACGCCCAAGGTGGGCCAGTGGGTGGGCACGGTGCTGCTGCACTGCTGCGAGCTCATCGAGCGGCCCTCCAAGAAGGACGGCTTCTGCTTCAAGCTCTTCCACCCGCTGGATCAGTCCGTCTGGGCCGTGAAGGGCCCCAAAGGTGAGAGCGTGGGCTCCATCACACAGCCCCTGCCCAGCAGCTACCTGATCTTCAGGGCCGCCTCCGAGTCAGATGGTCGCTGCTGGCTGGACGCCCTGGAGCTGGCCCTGCGCTGCTCTAGCCTACTGAGACTGGGCACCTGCAAGCCGGGCCGAGACGGGGAGCCAGGGACCTCGCCAGACGCATCACCCTCATCGCTCTGTGGGCTGCCAGCCTCAGCCACCGTCCACCCAGACCAAGACCTGTTCCCACTGAACGGGTCTTCCCTGGAGAACGATGCATTCTCAGACAAGTCGGAGAGAGAGAACCCTGAGGAGTCAGATACCGAGACCCAGGACCATAGCCGGAAGACGGAGAGTGGCAGCGACCAGTCAGAGACCCCTGGGGCCCCGGTGCGGAGAGGGACCACCTATGTGGAGCAGGTCCAGGAGGAGCTGGGGGAGCTGGGCGAGGCGTCCCAGGTGGAGACAGTGTCAGAGGAGAACAAGAGTCTGATGTGGACCCTGCTGAAGCAGCTACGGCCAGGCATGGACCTGTCCCGCGTGGTGCTACCCACGTTCGTACTGGAGCCGCGCTCCTTCCTGAACAAGCTCTCCGACTACTACTACCACGCAGACCTGCTCTCCAGGGCTGCGGTGGAGGAGGATGCCTACAGCCGCATGAAGCTGGTGCTGCGGTGGTACCTGTCTGGCTTCTACAAGAAGCCCAAGGGAATCAAGAAGCCGTACAACCCCATCCTGGGGGAGACCTTCCGCTGCTGCTGGTTCCACCCGCAGACTGACAGCCGCACATTCTACATAGCAGAGCAGGTGTCCCACCACCCGCCCGTGTCTGCCTTCCACGTCAGCAACCGGAAGGACGGCTTCTGCATCAGTGGCAGCATCACAGCCAAGTCCAGGTTTTATGGGAACTCGCTGTCGGCGCTGCTGGACGGCAAAGCCACGCTCACCTTCCTGAACCGAGCCGAGGATTACACCCTTACCATGCCCTACGCCCACTGCAAAGGAATCCTGTATGGCACGATGACCCTGGAGCTGGGTGGGAAGGTCACCATCGAGTGTGCGAAGAACAACTTCCAGGCCCAGCTGGAATTCAAACTCAAGCCCTTCTTCGGGGGTAGCACCAGCATCAACCAGATCTCGGGAAAGATCACGTCGGGAGAGGAAGTCCTGGCGAGCCTCAGTGGCCACTGGGACAGGGACGTGTTTATCAAGGAGGAAGGGAGCGGAAGCAGTGCGCTTTTCTGGACCCCGAGCGGGGAGGTCCGCAGACAGAGGCTGAGGCAGCACACGGTGCCGCTGGAGGAGCAGACGGAGCTGGAGTCCGAGAGGCTCTGGCAGCACGTCACCAGGGCCATCAGCAAGGGCGACCAGCACAGGGCCACACAGGAGAAGTTTGCACTGGAGGAGGCACAGCGGCAGCGGGCCCGTGAGCGGCAGGAGAGCCTCATGCCCTGGAAGCCGCAGCTGTTCCACCTGGACCCCATCACCCAGGAGTGGCACTACCGATACGAGGACCACAGCCCCTGGGACCCCCTGAAGGACATCGCCCAGTTTGAGCAAGACGGGATCCTGCGGACCTTGCAGCAGGAGGCCGTGGCCCGCCAGACCACCTTCCTGGGCAGCCCAGGGCCCAGGCACGAGAGGTCTGGCCCAGACCAGCGGCTTCGCAAGGCCAGCGACCAGCCCTCCGGCCACAGCCAGGCCACGGAGAGCAGCGGATCCACGCCTGAGTCCTGCCCAGAGCTCTCAGACGAGGAGCAGGATGGTGACTTTGTCCCTGGCGGTGAGAGCCCATGCCCTCGGTGCAGGAAGGAGGCGCGGCGGCTGCAGGCCCTGCACGAGGCCATCCTCTCCATCCGAGAGGCCCAGCAGGAGCTGCACAGGCACCTCTCGGCCATGCTGAGCTCCACGGCACGGGCAGCACAGGCACCGACCCCAGGCCTCCTGCAGAGCCCCCGATCCTGGTTCCTGCTCTGCGTGTTCCTGGCGTGTCAGCTGTTCATTAACCACATCCTCAAATAG

Length: 2640

View AllClose

0 Reviews

View AllClose