Human ORMDL2 cDNA Clone BC012543 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL690476HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ORMDL2
Gene ID:
29095
Accession #:
BC012543
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human ORMDL2 cDNA Clone BC012543 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ORMDL2

Gene ID: 29095

Accession Number: BC012543

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAATGTGGGGGTGGCACACAGCGAAGTAAACCCCAACACCCGAGTGATGAATAGCCGAGGCATCTGGCTGGCCTACATCATCTTGGTAGGATTGCTGCATATGGTTCTACTCAGCATCCCCTTCTTCAGCATTCCTGTTGTCTGGACCCTGACCAACGTCATCCATAACCTGGCTACGTATGTCTTCCTTCATACGGTGAAAGGGACACCCTTTGAGACTCCTGACCAAGGAAAGGCCCGGCTACTGACACACTGGGAGCAAATGGACTATGGGCTCCAGTTTACCTCTTCCCGCAAGTTCCTCAGCATCTCTCCTATTGTGCTCTATCTCCTGGCCAGCTTCTATACCAAGTATGATGCTGCGCACTTCCTCATCAACACAGCCTCATTGCTAAGTGTACTGCTGCCGAAGTTGCCCCAGTTCCATGGGGTTCGTGTCTTTGGCATCAACAAATACTGA

Length: 462

View AllClose

0 Reviews

View AllClose