Human ORMDL1 cDNA Clone BC005200 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL868379HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ORMDL1
Gene ID:
94101
Accession #:
BC005200
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ORMDL1 cDNA Clone BC005200 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ORMDL1

Gene ID: 94101

Accession Number: BC005200

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAACGTTGGAGTTGCCCACAGTGAAGTGAATCCAAATACCCGTGTCATGAACAGCCGGGGTATGTGGCTGACATATGCATTGGGAGTTGGCTTGCTTCATATTGTCTTACTCAGCATTCCCTTCTTCAGTGTTCCTGTTGCTTGGACTTTAACAAATATTATACATAATCTGGGGATGTACGTATTTTTGCATGCAGTGAAAGGAACACCTTTCGAAACTCCTGACCAGGGTAAAGCAAGGCTCCTAACTCATTGGGAACAACTGGACTATGGAGTACAGTTTACATCTTCACGGAAGTTTTTCACAATTTCTCCAATAATTCTATATTTTCTGGCAAGTTTCTATACGAAGTATGATCCAACTCACTTCATCCTAAACACAGCTTCTCTCCTGAGTGTACTAATTCCCAAAATGCCACAACTACATGGTGTTCGGATCTTTGGAATTAATAAGTATTGA

Length: 462

View AllClose

0 Reviews

View AllClose