Human ORM2 cDNA Clone BC015964 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL017238HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ORM2
Gene ID:
5005
Accession #:
BC015964
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human ORM2 cDNA Clone BC015964 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ORM2

Gene ID: 5005

Accession Number: BC015964

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCGCTGTCCTGGGTTCTTACAGTCCTGAGCCTCCTACCTCTGCTGGAAGCCCAGATCCCATTGTGTGCCAACCTAGTACCGGTGCCCATCACCAACGCCACCCTGGACCGGATCACTGGCAAGTGGTTTTATATCGCATCGGCCTTTCGAAACGAGGAGTACAATAAGTCGGTTCAGGAGATCCAAGCAACCTTCTTTTACTTTACCCCCAACAAGACAGAGGACACGATCTTTCTCAGAGAGTACCAGACCCGCCAGAACCAGTGCTTCTATAACTCCAGTTACCTGAATGTCCAGCGGGAGAATGGGACCGTCTCCAGATACGAGGGAGGCCGAGAACATGTTGCTCACCTGCTGTTCCTTAGGGACACCAAGACCTTGATGTTTGGTTCCTACCTGGACGATGAGAAGAACTGGGGGCTGTCTTTCTATGCTGACAAGCCAGAGACGACCAAGGAGCAACTGGGAGAGTTCTACGAAGCTCTCGACTGCTTGTGCATTCCCAGGTCAGATGTCATGTACACCGACTGGAAAAAGGATAAGTGTGAGCCACTGGAGAAGCAGCACGAGAAGGAGAGGAAACAGGAGGAGGGGGAATCCTAG

Length: 606

View AllClose

0 Reviews

View AllClose