Human ORM1 cDNA Clone BC026238 pENTR223.1 Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL017237HU
Availability:
3 to 5 Working Days
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ORM1
Gene ID:
5004
Accession #:
BC026238
Plasmid:
pENTR223.1
€214.00
Frequently bought together:

Description

Human ORM1 cDNA Clone BC026238 pENTR223.1 Plasmid | Cusabio

Gene Name: ORM1

Gene ID: 5004

Accession Number: BC026238

Vector: pENTR223.1

Sequence: ATGGCGCTGTCCTGGGTTCTTACAGTCCTGAGCCTCCTACCTCTGCTGGAAGCCCAGATCCCATTGTGTGCCAACCTAGTACCGGTGCCCATCACCAACGCCACCCTGGACCGGATCACTGGCAAGTGGTTTTATATCGCATCGGCCTTTCGAAACGAGGAGTACAATAAGTCGGTTCAGGAGATCCAAGCAACCTTCTTTTACTTCACCCCCAACAAGACAGAGGACACGATCTTTCTCAGAGAGTACCAGACCCGACAGGACCAGTGCATCTATAACACCACCTACCTGAATGTCCAGCGGGAAAATGGGACCATCTCCAGATACGTGGGAGGCCAAGAGCATTTCGCTCACTTGCTGATCCTCAGGGACACCAAGACCTACATGCTTGCTTTTGACGTGAACGATGAGAAGAACTGGGGGCTGTCTGTCTATGCTGACAAGCCAGAGACGACCAAGGAGCAACTGGGAGAGTTCTACGAAGCTCTCGACTGCTTGCGCATTCCCAAGTCAGATGTCGTGTACACCGATTGGAAAAAGGATAAGTGTGAGCCACTGGAGAAGCAGCACGAGAAGGAGAGGAAACAGGAGGAGGGGGAATCCTAG

Length: 606

View AllClose

0 Reviews

View AllClose