Human ORAI1 cDNA Clone BC013386 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL846601HU2
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
ORAI1
Gene ID:
84876
Accession #:
BC013386
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
£171.20
Frequently bought together:

Description

Human ORAI1 cDNA Clone BC013386 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: ORAI1

Gene ID: 84876

Accession Number: BC013386

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAGCCTCAACGAGCACTCCATGCAGGCGCTGTCCTGGCGCAAGCTCTACTTGAGCCGCGCCAAGCTTAAAGCCTCCAGCCGGACCTCGGCTCTGCTCTCCGGCTTCGCCATGGTGGCAATGGTGGAGGTGCAGCTGGACGCTGACCACGACTACCCACCGGGGCTGCTCATCGCCTTCAGTGCCTGCACCACAGTGCTGGTGGCTGTGCACCTGTTTGCGCTCATGATCAGCACCTGCATCCTGCCCAACATCGAGGCGGTGAGCAACGTGCACAATCTCAACTCGGTCAAGGAGTCCCCCCATGAGCGCATGCACCGCCACATCGAGCTGGCCTGGGCCTTCTCCACCGTCATCGGCACGCTGCTCTTCCTAGCTGAGGTGGTGCTGCTCTGCTGGGTCAAGTTCTTGCCCCTCAAGAAGCAGCCAGGCCAGCCAAGGCCCACCAGCAAGCCCCCCGCCGGTGGCGCAGCAGCCAACGTCAGCACCAGCGGCATCACCCCGGGCCAGGCAGCCGCCATCGCCTCGACCACCATCATGGTGCCCTTCGGCCTGATCTTTATCGTCTTCGCCGTCCACTTCTACCGCTCACTGGTCAGCCATAAGACCGACCGACAGTTCCAGGAGCTCAACGAGCTGGCGGAGTTTGCCCGCTTACAGGACCAGCTGGACCACAGAGGGGACCACCCCCTGACGCCCGGCAGCCACTATGCCTAG

Length: 717

View AllClose

0 Reviews

View AllClose