Human OR8B8 cDNA Clone BC130393 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL620887HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR8B8
Gene ID:
26493
Accession #:
BC130393
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR8B8 cDNA Clone BC130393 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR8B8

Gene ID: 26493

Accession Number: BC130393

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGCTGCTGAGAATTCCTCCTTCGTGACACAGTTTATCCTCGCAGGCTTAACTGACCAACCGGGAGTCCAGATCCCCCTCTTCTTCCTGTTTCTAGGCTTCTACGTGGTCACTGTGGTGGGGAACCTGGGCTTGATAACCCTGATAAGGCTCAACTCTCACTTGCACACCCCTATGTACTTCTTCCTCTATAACTTGTCCTTCATAGATTTCTGCTATTCCAGTGTTATCACTCCCAAAATGCTGATGAGCTTTGTCTTAAAGAAGAACAGCATCTCCTACGCAGGGTGTATGACTCAGCTCTTCTTCTTTCTTTTCTTTGTTGTCTCTGAGTCCTTCATCCTGTCAGCAATGGCGTATGACCGCTATGTGGCCATCTGTAACCCACTGTTGTACATGGTCACCATGTCTCCCCAGGTGTGTTTTCTCCTTTTGTTGGGTGTCTATGGGATGGGGTTTGCTGGGGCCATGGCCCACACAGCGTGCATGATGGGTGTGACCTTCTGTGCCAATAACCTTGTCAACCACTACATGTGTGACATCCTTCCCCTTCTTGAGTGTGCTTGCACCAGCACCTATGTGAATGAGCTTGTAGTGTTTGTTGTTGTGGGCATTGATATTGGTGTGCCCACAGTCACCATCTTCATTTCCTATGCTCTCATTCTCTCCAGCATCTTCCACATTGATTCCACGGAGGGCAGGTCCAAAGCCTTCAGCACCTGCAGCTCCCACATAATTGCAGTTTCTCTGTTCTTTGGGTCAGGAGCATTCATGTACCTCAAACCCTTTTCTCTTTTAGCTATGAACCAGGGCAAGGTGTCTTCCCTATTCTATACCACTGTGGTGCCCATGCTCAACCCATTAATTTATAGCCTGAGGAATAAGGACGTCAAAGTTGCTCTAAAGAAAATCTTGAACAAAAATGCATTCTCCTGA

Length: 936

View AllClose

0 Reviews

View AllClose