Human OR7C1 cDNA Clone BC117212 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL017055HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR7C1
Gene ID:
26664
Accession #:
BC117212
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR7C1 cDNA Clone BC117212 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR7C1

Gene ID: 26664

Accession Number: BC117212

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAAACAGGAAATCAAACACATGCCCAAGAATTTCTCCTCCTGGGATTTTCAGCAACGTCAGAGATTCAGTTCATTCTCTTTGGGCTGTTCCTCTCCATGTACCTAGTCACTTTCACCGGGAACCTGCTCATCATCCTGGCCATATGCTCAGACTCCCACCTCCACACCCCCATGTACTTCTTCCTCTCCAACCTGTCTTTTGCTGACCTCTGTTTTACCTCCACGACTGTCCCAAAGATGTTACTGAATATACTGACACAGAACAAATTCATAACATATGCAGGCTGTCTCAGTCAGATTTTTTTTTTCACTTCATTTGGATGCCTGGACAATTTACTCTTGACCGTGATGGCCTATGACCGCTTCGTGGCCATCTGTCACCCCCTGCACTATACGGTCATCATGAACCCCCAGCTCTGTGGACTGCTGGTTCTGGGGTCCTGGTGCATCAGTGTCATGGGTTCCCTGCTCGAGACCTTGACTGTTTTGAGGCTGTCCTTCTGCACCAAAATGGAAATTCCACACTTTTTTTGTGATCTACTTGAAGTCCTGAAGCTCGCCTGTTCTGACACCTTCATTAATAACGTGGTGATATACTTTGCAACTGGCGTCCTGGGTGTGATTTCCTTCACTGGAATATTTTTCTCTTACTATAAAATTGTTTTCTCTATACTGAGGATTTCCTCAGCTGGGAGAAAGCACAAAGCGTTTTCCACCTGTGGTTCCCACCTCTCAGTGGTCACCTTGTTCTATGGCACGGGCTTTGGGGTCTATCTCAGTTCTGCAGCCACACCATCTTCTAGGACAAGTCTGGTGGCCTCAGTGATGTACACCATGGTCACCCCCATGCTGAACCCCTTCATCTACAGCCTGAGGAACACGGACATGAAGAGGGCCCTGGGGAGACTCCTCAGTAGGGCAACATTTTTTAATGGTGACATCACTGCAGGACTTTCATAA

Length: 963

View AllClose

0 Reviews

View AllClose