Human OR5F1 cDNA Clone BC101239 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016940HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR5F1
Gene ID:
338674
Accession #:
BC101239
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR5F1 cDNA Clone BC101239 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR5F1

Gene ID: 338674

Accession Number: BC101239

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGACCAGAAAAAATTATACCTCACTGACTGAGTTCGTCCTATTGGGATTAGCAGACACGCTGGAGCTACAGATTATCCTCTTTTTGTTTTTTCTTGTGATTTATACACTTACAGTACTGGGAAATCTCGGGATGATCCTCTTAATCAGGATCGATTCCCAGCTTCACACACCCATGTATTTCTTCCTGGCTAACCTGTCCTTTGTGGACGTTTGTAACTCAACTACCATCACCCCAAAGATGCTGGCAGATTTATTATCAGAGAAGAAAACCATCTCTTTTGCTGGCTGCTTCCTACAGATGTACTTCTTTATCTCCCTGGCGACAACCGAATGCATCCTCTTTGGGTTAATGGCCTATGACCGGTATGCGGCCATATGTCGCCCGCTGCTTTACTCCTTGATCATGTCCAGGACCGTCTACCTAAAAATGGCAGCCGGGGCTTTTGCTGCAGGGTTGCTGAACTTCATGGTCAACACAAGCCATGTCAGCAGCTTGTCATTCTGTGACTCCAATGTCATCCATCACTTCTTCTGTGACAGTCCCCCACTTTTCAAGCTCTCTTGTTCTGACACAATCCTGAAAGAAAGCATAAGTTCTATTTTGGCTGGTGTGAATATTGTGGGGACTCTGCTTGTCATCCTCTCCTCCTACTCCTACGTTCTCTTCTCCATTTTTTCTATGCATTCGGGGGAGGGGAGGCACAGAGCTTTCTCCACGTGTGCCTCTCACCTGACAGCCATAATTCTGTTCTATGCCACCTGCATCTATACTTACCTGAGACCTAGTTCCAGCTACTCCCTGAATCAGGACAAAGTGGCTTCTGTGTTCTACACAGTGGTGATTCCCATGTTGAATCCTCTGATCTACAGCCTCAGGAATAAGGAAGTAAAGAAGGCTTTAGCGAATGTAATTAGCAGGAAAAGGACCTCTTCCTTTCTGTGA

Length: 945

View AllClose

0 Reviews

View AllClose