Human OR3A1 cDNA Clone BC096187 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016636HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR3A1
Gene ID:
4994
Accession #:
BC096187
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR3A1 cDNA Clone BC096187 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR3A1

Gene ID: 4994

Accession Number: BC096187

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGCAGCCAGAATCTGGGGCCAATGGAACAGTCATTGCTGAGTTCATCCTGCTGGGCTTGCTGGAGGCGCCAGGGCTGCAGCCAGTTGTCTTTGTGCTCTTCCTCTTTGCCTACCTGGTCACGGTCAGGGGCAACCTCAGCATCCTGGCAGCTGTCTTGGTGGAGCCCAAACTCCACACCCCCATGTACTTCTTCCTGGGGAACCTATCAGTGCTGGATGTTGGGTGCATCAGCGTCACTGTTCCATCAATGTTGAGTCGTCTCCTGTCCCGCAAGCGTGCAGTTCCCTGTGGGGCCTGCCTTACCCAGCTCTTCTTCTTCCATCTGTTCGTTGGAGTGGACTGCTTCCTGCTGACCGCCATGGCCTATGACCGATTCCTGGCCATCTGCCGGCCCCTCACCTACAGCACCCGCATGAGTCAGACAGTCCAGAGGATGTTGGTGGCTGCGTCCTGGGCTTGTGCTTTCACCAACGCACTGACCCACACTGTGGCCATGTCCACGCTCAACTTCTGTGGCCCCAATGTGATCAATCACTTCTACTGTGACCTCCCACAGCTCTTCCAGCTCTCCTGCTCCAGCACCCAACTCAATGAGCTGCTGCTTTTTGCTGTGGGTTTTATAATGGCAGGTACCCCCATGGCTCTCATTGTCATCTCCTATATCCACGTGGCAGCTGCAGTCCTGCGAATTCGCTCTGTAGAGGGCAGGAAGAAAGCCTTCTCCACATGTGGCTCCCACCTCACTGTGGTTGCCATATTCTATGGTTCAGGTATCTTTAACTATATGCGACTGGGTTCAACCAAGCTTTCAGACAAGGATAAAGCTGTTGGAATTTTCAACACTGTCATCAATCCCATGCTGAACCCAATCATCTACAGCTTCAGAAACCCTGATGTGCAGAGTGCCATCTGGAGGATGCTCACAGGGAGGCGGTCACTGGCTTGA

Length: 948

View AllClose

0 Reviews

View AllClose