Human OR2S2 cDNA Clone BC113651 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL873623HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR2S2
Gene ID:
56656
Accession #:
BC113651
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR2S2 cDNA Clone BC113651 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR2S2

Gene ID: 56656

Accession Number: BC113651

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAAAAAGCCAATGAGACCTCCCCTGTGATGGGGTTCGTTCTCCTGAGGCTCTCTGCCCACCCAGAGCTGGAAAAGACATTCTTCGTGCTCATCCTGCTGATGTACCTCGTGATCCTGCTGGGCAATGGGGTCCTCATCCTGGTGACCATCCTTGACTCCCGCCTGCACACGCCCATGTACTTCTTCCTAGGGAACCTCTCCTTCCTGGACATCTGCTTCACTACCTCCTCAGTCCCACTGGTCCTGGACAGCTTTTTGACTCCCCAGGAAACCATCTCCTTCTCAGCCTGTGCTGTGCAGATGGCACTCTCCTTTGCCATGGCAGGAACAGAGTGCTTGCTCCTGAGCATGATGGCATTTGATCGCTATGTGGCCATCTGCAACCCCCTTAGGTACTCCGTGATCATGAGCAAGGCTGCCTACATGCCCATGGCTGCCAGCTCCTGGGCTATTGGTGGTGCTGCTTCCGTGGTACACACATCCTTGGCAATTCAGCTGCCCTTCTGTGGAGACAATGTCATCAACCACTTCACCTGTGAGATTCTGGCTGTTCTAAAGTTGGCCTGTGCTGACATTTCCATCAATGTGATCAGCATGGAGGTGACGAATGTGATCTTCCTAGGAGTCCCGGTTCTGTTCATCTCTTTCTCCTATGTCTTCATCATCACCACCATCCTGAGGATCCCCTCAGCTGAGGGGAGGAAAAAGGTCTTCTCCACCTGCTCTGCCCACCTCACCGTGGTGATCGTCTTCTACGGGACCTTATTCTTCATGTATGGGAAGCCTAAGTCTAAGGACTCCATGGGAGCAGACAAAGAGGATCTTTCAGACAAACTCATCCCCCTTTTCTATGGGGTGGTGACCCCGATGCTCAACCCCATCATCTATAGCCTGAGGAACAAGGATGTGAAGGCTGCTGTGAGGAGACTGCTGAGACCAAAAGGCTTCACTCAGTGA

Length: 960

View AllClose

0 Reviews

View AllClose