Human OR2L13 cDNA Clone BC028158 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL822694HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR2L13
Gene ID:
284521
Accession #:
BC028158
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
$256.80
Frequently bought together:

Description

Human OR2L13 cDNA Clone BC028158 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR2L13

Gene ID: 284521

Accession Number: BC028158

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAGAAATGGAATCACACTTCAAATGATTTCATTTTGTTGGGTCTGCTTCCCCCAAATCAAACTGGAATATTTCTCTTGTGCCTTATCATCCTCATATTCTTTCTGGCCTCGGTGGGTAACTCGGCCATGATTCACCTCATCCACGTGGATCCTCGTCTCCACACACCGATGTACTTTCTTCTCAGCCAGCTCTCCCTTATGGACCTGATGTACATCTCCACCACCGTCCCCAAGATGGCGTACAACTTCCTGTCCGGCCAGAAAGGCATCTCCTTCCTGGGATGTGGTGTGCAAAGCTTCTTCTTCCTGACCATGGCGTGTTCTGAAGGCTTACTCCTGACCTCCATGGCCTACGACCGTTATTTGGCCATCTGCCACTCTCTCTATTATCCTATCCGCATGAGTAAAATGATGTGTGTGAAGATGATTGGAGGCTCTTGGACACTGGGGTCCATCAACTCCTTGGCACACACAGTCTTTGCCCTTCATATTCCCTACTGCAGGTCTAGGGCTATTGACCATTTCTTCTGCGATGTCCCAGCCATGTTGCTTCTTGCCTGTACAGATACTTGGGTCTATGAATATATGGTTTTTGTAAGTACAAGCCTCTTTCTCCTTTTCCCTTTCATTGGCATCACTTCTTCCTGTGGCCGAGTCCTATTTGCTGTCTATCATATGCACTCAAAGGAGGGGAGAAAAAAGGCCTTCACCACCATTTCAACACATTTAACTGTAGTGATCTTTTACTATGCACCTTTTGTCTACACCTATCTTCGGCCCAGGAATCTCCGCTCACCAGCTGAAGACAAGATCCTGGCAGTCTTCTACACCATCCTTACCCCCATGCTCAATCCCATTATCTACAGCCTGAGGAATAAGGAAGTCCTGGGGGCTATGAGGAGAGTGTTTGGGATATTCTCTTTCCTGAAAGAATAA

Length: 939

View AllClose

0 Reviews

View AllClose