Human OR2J2 cDNA Clone BC108898 pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016582HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR2J2
Gene ID:
26707
Accession #:
BC108898
Plasmid:
pUC
€344.00
Frequently bought together:

Description

Human OR2J2 cDNA Clone BC108898 pUC Plasmid | Cusabio

Gene Name: OR2J2

Gene ID: 26707

Accession Number: BC108898

Vector: pUC

Sequence: ATGATGATTAAAAAAAATGCAAGTTCGGAAGACTTCTTTATTCTACTTGGATTTTCTAATTGGCCTCAGCTGGAAGTAGTTCTCTTTGTGGTTATCTTGATCTTCTACCTGATGACACTGACAGGAAACCTGTTCATCATCATCCTGTCATACGTGGACTCCCATCTCCACACACCAATGTACTTCTTCCTTTCAAACCTCTCATTTCTGGATCTCTGCTACACCACCAGCTCTATCCCTCAGTTGCTGGTGAATCTCCGGGGCCCGGAAAAGACCATCTCGTATGCTGGTTGCATGGTTCAACTTTACTTTGTTCTTGCACTGGGAATCGCAGAGTGTGTCCTACTGGTGGTGATGTCATATGATCGTTATGTAGCTGTGTGTAGACCTTTGCATTACACTGTCCTCATGCACCCTCGTTTCTGCCACTTGTTGGTTGCGGCTTCTTGGGTAATTGGTTTTACTATCTCAGCACTTCATTCCTCCTTTACTTTCTGGGTACCCCTTTGTGGACATCGCCTAGTGGATCACTTCTTCTGTGAAGTTCCAGCACTTCTGCGTTTATCATGTGTTGACACCCATGCAAATGAGCTGACCCTCATGGTCATGAGCTCCATTTTTGTTCTCATACCTCTCATTCTCATTCTCACTACCTATGGTGCCATTGCCCGGGCTGTACTGAGCATGCAATCAACCACTGGGCTTCAGAAAGTGTTTAGGACATGTGGAGCCCATCTTATGGTTGTATCTCTCTTTTTCATTCCAGTCATGTGCATGTATCTCCAGCCACCATCAGAAAATTCTCCTGATCAGGGCAAGTTCATTGCCCTCTTTTATACTGTTGTCACACCGAGTCTTAATCCTCTAATCTACACTCTCAGAAACAAGCATGTAAAAGGGGCAGCGAAGAGACTATTGGGGTGGGAGTGGGGGAAGTGA

Length: 939

View AllClose

0 Reviews

View AllClose