Human OR2H1 cDNA Clone BC048991 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL875629HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR2H1
Gene ID:
26716
Accession #:
BC048991
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR2H1 cDNA Clone BC048991 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR2H1

Gene ID: 26716

Accession Number: BC048991

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGTTAACCAAAGCTCCCCCATGGGCTTCCTCCTTCTGGGCTTCTCTGAACACCCAGCACTGGAAAGGACTCTCTTTGTGGTTGTCTTCACTTCCTACCTCTTGACCCTGGTGGGCAACACACTCATCATCCTGCTGTCTGTACTGTACCCCAGGCTCCACTCTCCAATGTACTTTTTCCTCTCTGACCTCTCCTTCTTGGACCTCTGCTTTACCACAAGTTGTGTCCCCCAGATGCTGGTCAACCTCTGGGGCCCAAAGAAGACCATCAGCTTCCTGGGATGCTCTGTCCAGCTCTTCATCTTCCTGTCCCTGGGGACCACTGAGTGCATCCTCCTGACAGTGATGGCCTTTGACCGATACGTGGCTGTCTGCCAGCCCCTCCACTATGCCACCATCATCCACCCCCGCCTGTGCTGGCAGCTGGCATCTGTGGCCTGGGTTATGAGTCTGGTTCAATCGATAGTCCAGACACCATCCACCCTCCACTTGCCCTTCTGTCCCCACCAGCAGATAGATGACTTTTTATGTGAGGTCCCATCTCTGATTCGACTCTCCTGTGGAGATACCTCCTACAATGAAATCCAGTTGGCTGTGTCCAGTGTCATCTTCGTGGTTGTGCCTCTCAGCCTCATCCTTGCCTCTTATGGAGCCACTGCCCAGGCAGTGCTGAGGATTAACTCTGCCACAGCATGGAGAAAGGCCTTTGGGACCTGCTCCTCCCATCTCACTGTGGTCACCCTCTTCTACAGCTCAGTCATTGCTGTCTACCTCCAGCCCAAAAATCCGTATGCCCAAGGGAGGGGCAAGTTCTTTGGTCTCTTCTATGCAGTGGGCACTCCTTCACTTAACCCTCTCGTATACACCCTGAGGAACAAGGAGATAAAGCGAGCACTCAGGAGGTTACTAGGGAAGGAAAGAGACTCCAGGGAAAGCTGGAGAGCTGCTTAA

Length: 951

View AllClose

0 Reviews

View AllClose