Human OR2C3 cDNA Clone BC030717 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL854050HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR2C3
Gene ID:
81472
Accession #:
BC030717
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR2C3 cDNA Clone BC030717 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR2C3

Gene ID: 81472

Accession Number: BC030717

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGGAAATAGCCAATGTGAGTTCTCCAGAAGTCTTTGTCCTCCTGGGCTTCTCCGCACGACCCTCACTAGAAACTGTCCTCTTCATAGTTGTCTTGAGTTTTTACATGGTATCGATCTTGGGCAATGGCATCATCATTCTGGTCTCCCATACAGATGTGCACCTCCACACACCTATGTACTTCTTTCTTGCCAACCTCTCCTTCCTGGACATGAGCTTCACCACGAGCATTGTCCCACAGCTCCTGGCTAACCTCTGGGGACCACAGAAAACCATAAGCTATGGAGGGTGTGTGGTCCAGTTCTATATCTCCCATTGGCTGGGGGCAACCGAGTGTGTCCTGCTGGCCACCATGTCCTATGACCGCTACGCTGCCATCTGCAGGCCACTCCATTACACTGTCATTATGCATCCACAGCTTTGCCTTGGGCTAGCTTTGGCCTCCTGGCTGGGGGGTCTGACCACCAGCATGGTGGGCTCCACGCTCACCATGCTCCTACCGCTGTGTGGGAACAATTGCATCGACCACTTCTTTTGCGAGATGCCCCTCATTATGCAACTGGCTTGTGTGGATACCAGCCTCAATGAGATGGAGATGTACCTGGCCAGCTTTGTCTTTGTTGTCCTGCCTCTGGGGCTCATCCTGGTCTCTTACGGCCACATTGCCCGGGCCGTGTTGAAGATCAGGTCAGCAGAAGGGCGGAGAAAGGCATTCAACACCTGTTCTTCCCACGTGGCTGTGGTGTCTCTGTTTTACGGGAGCATCATCTTCATGTATCTCCAGCCAGCCAAGAGCACCTCCCATGAGCAGGGCAAGTTCATAGCTCTGTTCTACACCGTAGTCACTCCTGCGCTGAACCCACTTATTTACACCCTGAGGAACACGGAGGTGAAGAGCGCCCTCCGGCACATGGTATTAGAGAACTGCTGTGGCTCTGCAGGCAAGCTGGCGCAAATTTAG

Length: 960

View AllClose

0 Reviews

View AllClose