Human OR2B6 cDNA Clone BC109251 pENTR223.1 or pUC Plasmid

(No reviews yet) Write a Review
SKU:
CSB-CL016561HU
Availability:
Inquiry
Size:
10 μg plasmid + 200μl Glycerol
Gene:
OR2B6
Gene ID:
26212
Accession #:
BC109251
Plasmid:
Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
€214.00
Frequently bought together:

Description

Human OR2B6 cDNA Clone BC109251 pENTR223.1 or pUC Plasmid | Cusabio

Gene Name: OR2B6

Gene ID: 26212

Accession Number: BC109251

Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

Sequence: ATGAATTGGGTAAATGACAGCATCATACAGGAGTTTATTCTGCTGGGTTTCTCAGATCGACCTTGGCTGGAGTTTCCACTCCTTGTGGTCTTCTTGATTTCTTACACTGTGACCATCTTTGGCAATCTGACCATTATTCTAGTGTCACGCCTGGACACCAAACTTCATACCCCCATGTATTTTTTTCTTACCAATCTATCACTCCTGGATCTTTGTTACACCACATGTACAGTCCCACAAATGCTAGTAAATTTATGCAGCATCAGGAAAGTAATCAGTTATCGTGGCTGTGTAGCCCAGCTTTTCATATTTCTGGCCTTGGGGGCTACTGAATATCTTCTCCTGGCCGTCATGTCCTTTGATAGGTTTGTAGCTATTTGTCGGCCTCTCCATTACTCAGTTATCATGCACCAGAGACTCTGCCTCCAGTTGGCAGCTGCATCCTGGGTTACTGGTTTTAGTAACTCAGTGTGGTTGTCTACCCTGACTCTCCAGCTGCCACTCTGTGACCCCTATGTGATAGATCACTTTCTCTGTGAAGTCCCTGCACTGCTCAAGTTATCTTGTGTTGAGACAACAGCAAATGAGGCTGAACTATTCCTTGTCAGTGAGCTCTTCCATCTAATACCCCTGACACTCATCCTTATATCATATGCTTTTATTGTCCGAGCAGTATTGAGGATACAGTCTGCTGAAGGTCGACAAAAAGCATTTGGGACATGTGGTTCCCATCTAATTGTGGTGTCTCTTTTTTATAGTACAGCCGTCTCTGTGTACCTGCAACCACCTTCGCCCAGCTCCAAGGACCAAGGAAAGATGGTTTCTCTCTTCTATGGAATCATTGCACCCATGCTGAATCCCCTTATATATACACTTAGGAACAAGGAGGTAAAGGAAGGCTTTAAAAGGTTGGTTGCAAGAGTCTTCTTAATCAAGAAATAA

Length: 942

View AllClose

0 Reviews

View AllClose